Difference between revisions of "Part:BBa K608101"

 
 
(8 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K608101 short</partinfo>
 
<partinfo>BBa_K608101 short</partinfo>
  
CcaR is the response regulator to the green light receptor CcaS.
 
It belongs to the family of OmpR regulator class. CcaR consists of an N-terminal receiver domain that can be phosphorylated by CcaS and a C-terminal DNA-binding domain that binds directly to the promoter region of cpcG2.
 
  
  
<!-- Add more about the biology of this part here
+
CcaR is the response regulator of the green light receptor [https://parts.igem.org/Part:BBa_K608102 CcaS].<br/>
===Usage and Biology===
+
It belongs to the family of OmpR regulator class. CcaR consists of an N-terminal receiver domain that can be <br/>phosphorylated by CcaS and a C-terminal DNA-binding domain that binds directly to the promoter region of cpcG2.<br/>
 +
 
 +
[[Image:Ccar.jpg |400px]]
 +
<br/>
 +
<br/>
 +
 
 +
==Usage and Biology==
 +
 
 +
when we amplified CcaR from the whole ''Synechocystis'' genome via PCR, <br/> the primer had an overhang with a Ribosome Binding Site.<br/>
 +
If you want to use it you can clone it behind a promotor of choice.
 +
 
 +
<br/>
 +
 
 +
The promoter region used by J.J. Tabor et. al (2010)<br/>
 +
is a 238 bp long sequence upstream of the naitve output product ''cpcG''<br/>
 +
unfortunately we could not clone this part into an iGEM vector on time.<br/>
 +
<br/>
 +
To complete information for the green light system here is the sequence for the promoter region:<br/>
 +
 
 +
PcpcG2 <br/>
 +
agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgtt gcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttc aattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaactt ttaagtttaattactaactttatct
 +
<br/>
 +
 
  
 
<!-- -->
 
<!-- -->

Latest revision as of 03:44, 22 September 2011

CcaR, green light response regulator


CcaR is the response regulator of the green light receptor CcaS.
It belongs to the family of OmpR regulator class. CcaR consists of an N-terminal receiver domain that can be
phosphorylated by CcaS and a C-terminal DNA-binding domain that binds directly to the promoter region of cpcG2.

Ccar.jpg

Usage and Biology

when we amplified CcaR from the whole Synechocystis genome via PCR,
the primer had an overhang with a Ribosome Binding Site.
If you want to use it you can clone it behind a promotor of choice.


The promoter region used by J.J. Tabor et. al (2010)
is a 238 bp long sequence upstream of the naitve output product cpcG
unfortunately we could not clone this part into an iGEM vector on time.

To complete information for the green light system here is the sequence for the promoter region:

PcpcG2
agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgtt gcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttc aattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaactt ttaagtttaattactaactttatct


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 380
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]