Difference between revisions of "Part:BBa K627006:Design"

(→‎References)
(→‎References)
 
(2 intermediate revisions by the same user not shown)
Line 29: Line 29:
  
 
===References===
 
===References===
−
 
−
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
 
−
 
−
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74
 
  
 
Fuh G., Sidhu S.S. (2000). Efficient phage display of polypeptides fused to the carboxy-terminus of the M13 gene-3 minor coat protein. FEBS Lett. 480(2-3):231-4
 
Fuh G., Sidhu S.S. (2000). Efficient phage display of polypeptides fused to the carboxy-terminus of the M13 gene-3 minor coat protein. FEBS Lett. 480(2-3):231-4
 +
 +
Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H. R., Plückthun, A. (1997) Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J. Immunol. Meth. 201(1):35-55
  
 
Rakonjac J., Feng J., Model P. (1999). Filamentous phage are released from the bacterial membrane by a two-step mechanism involving a short C-terminal fragment of pIII. J Mol Biol. 289(5):1253-65
 
Rakonjac J., Feng J., Model P. (1999). Filamentous phage are released from the bacterial membrane by a two-step mechanism involving a short C-terminal fragment of pIII. J Mol Biol. 289(5):1253-65
 +
 +
Smith, G.P. (1985). Filamentous fusion phage: Novel expression vectors that display cloned antigens on the virus surface. Science 228: 1315-17
 +
 +
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
 +
 +
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Latest revision as of 02:42, 22 September 2011

Fusion part of mdnA gene (from mdn-cluster) with myc-tag and gene III


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

Gene III was amplified from the vector pak100 bla KDIR using the following primer

Forward:TAAGCTTCTAGATGGCCGGCGAGCAGAAGCTGATCTCTGAGGAAGACCTGGGTGGTGGCTCTGGTTCC

Reverse: TGCTTAGACGTCCTGCAGCGGCCGCTACTAGTATTAACCGGTAGACTCCTTATTACGCAGTA

The mdnA gene was amplified from the vector pARW089 using the following primer

Forward: TTCCATGGCGCCAGAGGAATCTAGATGGCATATCCCAACGATC

Reverse: CTTCTGACTGGGAAGATTATACCGGTTAATACTAGTAGCGGCCGCTGCAGGACGTC

Gene III was amplified from pak100blaKDIR and mdnA from pARW089 by PCR. The primers were designed to enable the introduction of iGEM. The PCR product gene III was digested by whereas the PCR product mdnA was digested by AgeI. Thus a mdnA-gene III fusion part according to RFC25 was generated whereby AgeI and NgoMIV overhangs are compatible and placed in frame with the protein sequence. The ligation of AgeI and NgoMIV overhangs resulted in a scar coding for the threonine and glycine. Because the introduction of restriction sites before mdnA leaded to a great distance between ribosome binding site and mdnA a second RBS was inserted among SfoI and XbaI recognition sites to ensure a sufficiently expression rate of the mdnA-geneIII-fusion gene. Between mdnA and gene III myc sequence was inserted.

Because this BioBrick is an expression part, the adenin of mdnA gene start codon is part of the XbaI recognition site. Further the sequence contains a AgeI recognition site after gene III.


Source

The BioBrick mdnA is a part of the microviridin gene (mdn) cluster which was isolated from Microcystis aeruginosa strain NIES-843.

References

Fuh G., Sidhu S.S. (2000). Efficient phage display of polypeptides fused to the carboxy-terminus of the M13 gene-3 minor coat protein. FEBS Lett. 480(2-3):231-4

Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H. R., Plückthun, A. (1997) Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J. Immunol. Meth. 201(1):35-55

Rakonjac J., Feng J., Model P. (1999). Filamentous phage are released from the bacterial membrane by a two-step mechanism involving a short C-terminal fragment of pIII. J Mol Biol. 289(5):1253-65

Smith, G.P. (1985). Filamentous fusion phage: Novel expression vectors that display cloned antigens on the virus surface. Science 228: 1315-17

Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74