Difference between revisions of "Part:BBa K549001"

Revision as of 18:35, 21 September 2011

Ni(II) dependent rcnA-promoter and GFP

E. coli has an RcnR-regulator that switches on the RcnA-Promotor in the presence of Ni(II). After induction GFP will be expressed.

E. coli has to be used as reporter organism since RcnR is not coded on the plasmid.

Usage and Biology

This BioBrick can be used to detect Ni(II)-Ions in water.

This is how it works:

The sensor is also sensing Co 2+, but not very sensitivly.

The promoter sequence of pnikA is missing in the part sequence below. This is the promoter sequence of pnikA directly upstream of the reporter gene. The promoter sequence also contains the first ca. 50 nt of nikA, i.e. its a translational fusion. ACGGATTGTATGAGACATGGCAACACCTGGTTAACAAGAATATGAAAAATCATAGCACTATTAATCTACTGGGGGGTAGT ATCAGGTACTGGGGGGGAGTAGAATCAGATTGCCGAATTAATACTAAGAATTATTATCATGACCGAATTTACAACTCTTC TTCAGCAAGGAAACGCCTGGTTCTTCATCCCCAGCGCCATCTTACTTGGTGCG

Sources: - [http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2958.2006.05369.x/pdf Nickel homeostasis in Escherichia coli – the rcnR-rcnA efflux pathway and its linkage to NikR function] Iwig JS, Rowe JL, Chivers PT
- [http://www.ncbi.nlm.nih.gov/pubmed?term=coordinating%20intracellular%20chivers Coordinating intracellular nickel-metal-site structure-function relationships and the NikR and RcnR repressors] Iwig JS, Chivers PT

Sequence and Features