|
|
Line 3: |
Line 3: |
| how you used this part and how it worked out. | | how you used this part and how it worked out. |
| | | |
− | ===Applications of BBa_K638402===
| |
− |
| |
− | This is an improved version of [https://parts.igem.org/Part:BBa_K233307 part BBa_K233307] designed to allow comparison with measurements of functionality in the literature, and to make it easier to synthesise.
| |
− |
| |
− | ===Producing BBa_k638402 from primer synthesis===
| |
− |
| |
− | We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as [https://parts.igem.org/Plasmid_backbones/Assembly_of_protein_fusions BBF RFC 23 or 25]. Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [http://www.cambridgeigem.org/RFC57.pdf Gibson Assembly].
| |
− |
| |
− | {| border="1" align="center" style="text-align:center;"
| |
− | !Name
| |
− | !Sequence
| |
− | !Tm
| |
− | |-
| |
− | |TorA FWD
| |
− | |ATGGCGAACAACGACTTATTTCAGGCTTCTCGGCGTCGCTTTCTGGCGCAGCTGGGCGGATTAACGGTGGCGGGT
| |
− | |70.98°C
| |
− | |-
| |
− | |TorA REV
| |
− | |TGCGGCTTGTGCTGCCGTCGCTCTGCGAGGAGTCAACAGCGACGGGCCCAACATACCCGCCACCGTTAATCCGCC
| |
− | |70.98°C
| |
− | |}
| |
− |
| |
− |
| |
− | Thermocycler profile: 10 cycles:
| |
− | Melt 95°C 10 sec /
| |
− | Anneal 65°C 30 sec /
| |
− | Extend 72°C 20 sec
| |
| | | |
| ===User Reviews=== | | ===User Reviews=== |
Latest revision as of 11:10, 21 September 2011
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
User Reviews
UNIQ9abb7a50a0cb7727-partinfo-00000000-QINU
UNIQ9abb7a50a0cb7727-partinfo-00000001-QINU