Difference between revisions of "Part:BBa K638402:Experience"

 
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
 
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
Line 5: Line 4:
  
 
===Applications of BBa_K638402===
 
===Applications of BBa_K638402===
 +
 +
This is an improved version of [https://parts.igem.org/Part:BBa_K233307 part BBa_K233307] designed to allow comparison with measurements of functionality in the literature, and to make it easier to synthesise. 
 +
 +
===Producing BBa_k638402 from primer synthesis===
 +
 +
We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as [https://parts.igem.org/Plasmid_backbones/Assembly_of_protein_fusions BBF RFC 23 or 25].  Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [www.synbio.org.uk/gibson/downloads/files/RFC57.pdf Gibson Assembly]]
 +
 +
<table border="1" style="text-align:center;word-wrap:break-word;width:700px;table-layout:fixed;">
 +
<tr>
 +
  <th style='width:20%;font-style:italic;'>Name</th>
 +
  <th style='width:70%;font-style:italic;'>Sequence</th>
 +
  <th style='width:10%;font-style:italic;'>Tm</th>
 +
</tr>
 +
<tr>
 +
  <td>TorA Fwd</td>
 +
  <td>ATGGCGAACAACGACTTATTTCAGGCTTCTCGGCGTCGCTTTCTGGCGCAGCTGGGCGGATTAACGGTGGCGGGT</td>
 +
  <td>70.98&deg;C</td>
 +
</tr>
 +
<tr>
 +
  <td>TorA Rev</td>
 +
  <td>TGCGGCTTGTGCTGCCGTCGCTCTGCGAGGAGTCAACAGCGACGGGCCCAACATACCCGCCACCGTTAATCCGCC</td>
 +
  <td>70.98&deg;C</td>
 +
</tr>
 +
 +
  
 
===User Reviews===
 
===User Reviews===

Revision as of 09:32, 21 September 2011

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K638402

This is an improved version of part BBa_K233307 designed to allow comparison with measurements of functionality in the literature, and to make it easier to synthesise.

Producing BBa_k638402 from primer synthesis

We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as BBF RFC 23 or 25. Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [www.synbio.org.uk/gibson/downloads/files/RFC57.pdf Gibson Assembly]]

User Reviews

UNIQ6b52c2a7b0e2448f-partinfo-00000000-QINU

UNIQ6b52c2a7b0e2448f-partinfo-00000001-QINU
Name Sequence Tm
TorA Fwd ATGGCGAACAACGACTTATTTCAGGCTTCTCGGCGTCGCTTTCTGGCGCAGCTGGGCGGATTAACGGTGGCGGGT 70.98°C
TorA Rev TGCGGCTTGTGCTGCCGTCGCTCTGCGAGGAGTCAACAGCGACGGGCCCAACATACCCGCCACCGTTAATCCGCC 70.98°C