Difference between revisions of "Part:BBa K358019:Experience"
(→‎Experiment 2-1 Quantitative characterization of lytic activity of λ lysis cassette)
 
(54 intermediate revisions by 2 users not shown)
Line 1: Line 1:
−
__NOTOC__
+
====Experiment 1 Characterization of lytic activity with time====
−
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
+
−
how you used this part and how it worked out.
+
  
−
===Applications of BBa_K358019===
+
To characterize the lytic activity of &lambda; lysis cassette in more detail, we focused on when cell lysis occurs after induction by IPTG. We did the experiment as this protocol, and we got the following data.
−
Using this part, we checked the function of SRRz gene.
+
Protocol
 +
# Pour 3mL of supplemented M9 medium to a Falcon tube.
 +
# Pick out a colony on the plate of E.coli and put into the Falcon tube.
 +
# Grow it at 30 degrees for 16h.
 +
# Dilute it 50 folds with the same media and incubate until OD550 is about 0.15.
 +
# Ditribute 3ml of the culture to falcon tubes and add certain amount of IPTG.
 +
# Incubate the cultures at 30 degrees and measure OD550 of them every 30 min
 +
[[Image:KyotoGrp101028-2.png|700px|thumb|center|Fig.1 The result of characterization of lytic activity with time.
 +
]]
 +
As Fig.1 shows, when E.coli starts to lyse depends on the strength of induction of IPTG.
 +
When the concentration of IPTG is 1mM, E.coli starts to lyse after 1.5h, in contrast, when it is 0.03mM, E.coli starts to lyse after 6h. This result suggests the following two facts.
 +
# To evaluate the lytic activity quantitatively, we must evaluate it after cell lysis becomes a steady state.
 +
# We can regulate freely when E.coli are lysed, by changing the strength of induction of λ Lysis cassette.
  
−
====Experiment1 Characterization of lytic activity with time====  
+
====Experiment 2-1 Quantitative characterization of lytic activity of λ lysis cassette ====
 +
A steady state of cell lysis caused by λ lysis cassette exists. So we evaluated the lytic activity by measuring OD550 of the cultures that were steady state of cell lysis.
  
−
To characterize the lytic activity of &lambda; lysis cassette in more detail, we focused on when cell lysis occurs after induction of IPTG. We did the experiment as this [[Team:Kyoto/Protocols#Measurement of lytic activity with time | protocol]], we got the following data
+
[[Image:KyotoFigL001.png|900px|thumb|center|Table 1 OD550 of each culture incubated 16h, 18h, 20h, with various concentration of IPTG. The number of colony indicates which colony the cultures are drived from. The values of OD550 of 16h, 18h, 20h are derived from the same culture with certain concentration of IPTG.]]
  
−
[[Image:KyotoGrp101028-2.png|600px|center]]
+
As table1 shows, all of the cultures in 18h seem to be a steady state of cell lysis.
  
 +
[[Image:KyotofigD002.png|600px|thumb|center|Fig.2 OD550 vs. RPU at 18h after induction. The IPTG concentration is converted to RPU using the result of characterization of R0011]]
  
−
As this figure shows, when E.coli starts to lyse depends on the strength of induction of IPTG.  
+
RPU is relative activity of promoter, so Fig. 2 shows the relationship between the lytic activity of λ lysis cassette and its expression level. The lysis cassette effectively induced cell lysis even when the expression was very repressed (0.2 RPU). Moreover, the activity of the cell lysis has a distinct threshold around 0.1 RPU. In case of the higher induction than 0.2 RPU, the cell populations reached a plateau but not zero.
−
When the concentration of IPTG is 1mM, E.coli starts to lyse after 1.5h, in contrast, when it is 0.03mM, E.coli starts to lyse after 6h.
+
  
 +
[[Image:KyotoCFU.png|600px|thumb|center|Fig.4 C.F.U. assay on 0.05 and 1.0mM IPTG concentration.]]
  
 +
At 18h, we did CFU assay on samples: 0, 0.02, 0.05, 0.5, 1.0mM IPTG concentration. We only succeeded on two samples: 0.05 and 1.0mM.
 +
On the sample of 0.05mM, the value was 3.4x10<sup>5</sup>c.f.u./ml, and 1.0mM, the value was 2.3x10<sup>4</sup>c.f.u./ml.
  
 +
====Experiment 2-2 Quantitative characterization of lytic activity of λ　lysis cassette ====
 +
We also did the another experiment to observe the steady state.
  
 +
[[Image:KyotofigD003.png|600px|thumb|center|Fig.3 OD550 vs Time. The result of characterization of lytic activity.]]
  
−
Culture condition:
+
As Fig.3 shows, the cell population had become to the steady state.
−
 
+
−
We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end.  We done the sequencing on this sample.
+
−
 
+
−
 
+
−
BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca
+
−
 
+
−
Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca
+
−
 
+
−
To avoid the mutation, we finally decided the cultural temperature at 30C.
+
  
 
===User Reviews===
 
===User Reviews===

Latest revision as of 18:41, 7 November 2010

Experiment 1 Characterization of lytic activity with time

To characterize the lytic activity of λ lysis cassette in more detail, we focused on when cell lysis occurs after induction by IPTG. We did the experiment as this protocol, and we got the following data. Protocol

  1. Pour 3mL of supplemented M9 medium to a Falcon tube.
  2. Pick out a colony on the plate of E.coli and put into the Falcon tube.
  3. Grow it at 30 degrees for 16h.
  4. Dilute it 50 folds with the same media and incubate until OD550 is about 0.15.
  5. Ditribute 3ml of the culture to falcon tubes and add certain amount of IPTG.
  6. Incubate the cultures at 30 degrees and measure OD550 of them every 30 min
Fig.1 The result of characterization of lytic activity with time.

As Fig.1 shows, when E.coli starts to lyse depends on the strength of induction of IPTG. When the concentration of IPTG is 1mM, E.coli starts to lyse after 1.5h, in contrast, when it is 0.03mM, E.coli starts to lyse after 6h. This result suggests the following two facts.

  1. To evaluate the lytic activity quantitatively, we must evaluate it after cell lysis becomes a steady state.
  2. We can regulate freely when E.coli are lysed, by changing the strength of induction of λ Lysis cassette.

Experiment 2-1 Quantitative characterization of lytic activity of λ lysis cassette

A steady state of cell lysis caused by λ lysis cassette exists. So we evaluated the lytic activity by measuring OD550 of the cultures that were steady state of cell lysis.

Table 1 OD550 of each culture incubated 16h, 18h, 20h, with various concentration of IPTG. The number of colony indicates which colony the cultures are drived from. The values of OD550 of 16h, 18h, 20h are derived from the same culture with certain concentration of IPTG.

As table1 shows, all of the cultures in 18h seem to be a steady state of cell lysis.

Fig.2 OD550 vs. RPU at 18h after induction. The IPTG concentration is converted to RPU using the result of characterization of R0011

RPU is relative activity of promoter, so Fig. 2 shows the relationship between the lytic activity of λ lysis cassette and its expression level. The lysis cassette effectively induced cell lysis even when the expression was very repressed (0.2 RPU). Moreover, the activity of the cell lysis has a distinct threshold around 0.1 RPU. In case of the higher induction than 0.2 RPU, the cell populations reached a plateau but not zero.

Fig.4 C.F.U. assay on 0.05 and 1.0mM IPTG concentration.

At 18h, we did CFU assay on samples: 0, 0.02, 0.05, 0.5, 1.0mM IPTG concentration. We only succeeded on two samples: 0.05 and 1.0mM. On the sample of 0.05mM, the value was 3.4x105c.f.u./ml, and 1.0mM, the value was 2.3x104c.f.u./ml.

Experiment 2-2 Quantitative characterization of lytic activity of λ　lysis cassette

We also did the another experiment to observe the steady state.

Fig.3 OD550 vs Time. The result of characterization of lytic activity.

As Fig.3 shows, the cell population had become to the steady state.

User Reviews

UNIQ560be0053f410d82-partinfo-00000000-QINU UNIQ560be0053f410d82-partinfo-00000001-QINU