Revision history of "J100465"

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • (cur | prev) 15:11, 8 November 2018JaneDiGregorio (Talk | contribs). . (1,896 bytes) (+1,896). . (Created page with "Part number: J100465 Sequence: pCloneRed_Thurs_AM_Yellow_Top: 5'-CGACAGTTTTTGACACTTTCATAACACCAAGCAACTAATATATAATCTATAACATACAA pCloneRed_Thurs_AM_Yellow_Bottom: 5'-CCGCT...")