View source for Part:BBa K4041008


__NOTOC__
<partinfo>BBa_K4041008 short</partinfo>

<br>Template for T7 transcription of crRNA for Vibrio pathogenic gene marker. Need to be used with a XbaI overnight clean cut or PCR for the transcription to end at break point, to generate a short crRNA instead of transcription doesn't end. Designed on 100% conserved region.



https://static.igem.org/mediawiki/parts/0/08/HKIS--crRNA_dem.png
<br>Figure 1: Demonstration for a 2 oligo anneal system that is similar to a plasmid double stranded transcription system. The upper strand is annealed to the “T7 promoter” primer for reverse transcription. Need to be used with a T7 promoter based short RNA transcription kit, like MEGAshortscript RNA transcription kit, followed by purification, like spin columns or lithium ion precipitation.


<br><br>
https://static.igem.org/mediawiki/parts/c/c9/HKIS--ureapage.png
<br>15% UREA Page (Run in room temperature with 80V), indicating that the crRNA is successfully transcribed

<br><br>
https://static.igem.org/mediawiki/parts/a/a9/HKIS--crRNAbuff.png
<br>crRNA used with single stranded template, showcasing that the crRNA best work with 1X NEB2.1 buffer and functions to cleave reporter very rapidly.

<table style="border-color:383737;" bgcolor="white">
            
                <tr>
                    <td>The following crRNA were proved to work in this block in in Vibrio</td>
                
                </tr>
<tr>
                    <td>TDH forward (crRNA1)</td>
<td>ACTGTGAACATTAATGATAA</td>
                
                </tr>

<tr>
                    <td>vcgC forward (crRNA3)</td>
<td>ATAGCACTAATGTGTCATCT</td>
                
                </tr>
<tr>
                    <td>vcgC reverse (crRNA4, with PAM)</td>
<td>GCGGAGACGAGATCGCTATC</td>
                
                </tr>
              
<tr>
                    <td>ctxA Forward (crRNA5)</td>
<td>TGATCATGCAAGAGGAACTC</td>
                
                </tr>

<tr>
                    <td>crRNA 2 (high background) and crRNA 6 (no cleavage signal) is not functional from design, and is discarded</td>

                
                </tr>
                
        </table>

<!-- Add more about the biology of this part here
===Usage and Biology===

<!-- -->
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K4041008 SequenceAndFeatures</partinfo>


<!-- Uncomment this to enable Functional Parameter display 
===Functional Parameters===
<partinfo>BBa_K4041008 parameters</partinfo>
<!-- -->