View source for Part:BBa K210012

__NOTOC__
<partinfo>BBa_K210012 short</partinfo>

This is a tandem sequence of lacI binding sites(GAAATGTGAGCGCTCACAACT)made by MPR. In the project "Time bomb" of iGEM Kyoto 2009, this part was used in order to stbilize linear DNA.

It is very difficult to clone this parts because tandem sequence can induce mutation. So, if you want to use this parts, you should cloning this under 32C under which it is liower possible that mutation happens.

<!-- Add more about the biology of this part here
===Usage and Biology===

<!-- -->
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K210012 SequenceAndFeatures</partinfo>


<!-- Uncomment this to enable Functional Parameter display 
===Functional Parameters===
<partinfo>BBa_K210012 parameters</partinfo>
<!-- -->