View source for Part:BBa K116609

__NOTOC__
<partinfo>BBa_K116609 short</partinfo>

 CIIICd: A modified version of the CIII coding region from ''&lambda; phage''.
 '''Original CIII''':
 '''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC'''
 '''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC
 AAACACTTATGGCTATCCAGAC</font>'''TAA'''

The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).

<!-- Add more about the biology of this part here
===Usage and Biology===

<!-- -->
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K116609 SequenceAndFeatures</partinfo>


<!-- Uncomment this to enable Functional Parameter display 
===Functional Parameters===
<partinfo>BBa_K116609 parameters</partinfo>
<!-- -->