View source for Part:BBa K2992016


__NOTOC__
<partinfo>BBa_K2992016 short</partinfo>

Promoter region from the ferredoxin gene of <i>C. sporogenes</i> with the corrected t14c substitution compared with Part: [https://parts.igem.org/Part:BBa_K2715002 BBa_K2715002]. 


===Usage and Biology===
P<i>fdx</i>  is a strong constitutive promoter which regulates the ferredoxin gene in <i>C. sporogenes</i>. Ferredoxin is an iron-sulfur protein involved in central redox reactions occurring during the general metabolism of Clostridia. P<i>fdx</i> was used in Nottingham’s 2018 iGEM project to drive the expression of various reporters (insert hyperlink). In our 2019 project, we sought to us P<i>fdx</i> to drive the expression of our volatile and FAST reporter genes for predicting the production of botulinum neurotoxin following food manufacture. During our experimentation, we noted an erroneous c14t substitution exists in the 2018 construct which presumably occurred through a SNP in the 5’-cloning primer. The promoter region and 5’-UTR was also predicted using BPROM in last year’s entry. This year we have used experimental data from our group to ascertain the transcription start site and to differentiate between the promoter and 5’-UTR regions accordingly (Cañadas et al., 2019). <br><br>

===Characterisation===

===Characterisation of P<em>fdx</em> with FAST in comparison with other <em>Clostridium</em> and <em>Escherichia coli</em> promoters.===

One of the goals of goal of this experiment was to characterize the Pfdx promoter in a composite part  ([https://parts.igem.org/wiki/index.php?title=Part:BBa_K2992043 BBa_K2992043]) with a new reporter protein, the Fluorescence-Activating and Absorption-Shifting Tag Protein (FAST, [https://parts.igem.org/wiki/index.php?title=Part:BBa_K2992000 BBa_K2992000]). The part was characterized through a fluorescence assay in <em>E.&nbsp;coli</em> as well as in <em>C.&nbsp;sporogenes</em>. Fluorescence is reported as Molecule Equivalent Fluorescence per Particle (MEFL/particle) as per the recommendation of the [https://2019.igem.org/Measurement/Protocols iGEM measurement Hub]. 

Additionally, while preparing the assay we also discovered a mistake in the BBa K2715011 part sequence: this part was described as the native P<em>fdx</em> promoter from <em>C.&nbsp;sporogenes</em>, but exhibited a point mutation compared to the Wild-Type strain (C14T). The mutation looked benign (190 bp away from START codon), but we decided to compare the registry part to the Wild-Type P<em>fdx</em> sequence to prove that both the Wild-Type and the registry version of the P<em>fdx</em> promoter were equivalent. The sequence of each part is given here for clarity, with the mismatch bolded: 

     >P<em>fdx</em> (BBa_K2992016): 
     gtgtagtagcctg<strong>C</strong>gaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagata
     ggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt 

     >[https://parts.igem.org/Part:BBa_K2715011 Bba_K2715011]: 
     gtgtagtagcctg<strong>T</strong>gaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagata
     ggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt 

P<em>fdx</em>-FAST was assayed along with the following composite parts:

     - P<em>ntnH</em>-FAST: [https://parts.igem.org/wiki/index.php?title=Part:BBa_K2992044 BBa_K2992044]<br>
     - No promoter-FAST: [https://parts.igem.org/wiki/index.php?title=Part:BBa_K2992042 BBa_K2992042]<br>

The following basic promoter parts upstream of the same <em>Clostridium acetobutylicum thl</em> 5'UTR ([https://parts.igem.org/Part:BBa_K2715019 BBa_K2715019]) and RBS ([https://parts.igem.org/Part:BBa_K2715009 BBa_K2715009]) followed by the FAST protein ([https://parts.igem.org/wiki/index.php?title=Part:BBa_K2992000 BBa_K2992000]) and the T<em>fdx</em> terminator ([https://parts.igem.org/Part:BBa_K2284012 BBa_K2284012]):<br>
     - P<em>fdx</em>_C14T: [https://parts.igem.org/Part:BBa_K2715011 Bba_K2715011]<br>
     - P<em>thl</em>: [https://parts.igem.org/Part:BBa_K2715010 BBa_K2715010]<br>
     - [https://parts.igem.org/Part:BBa_J23106 BBa_J23106]<br>

And finally this basic promoter part associated with the <em>Clostridium botulinum botR</em> 5'UTR and RBS ([https://parts.igem.org/Part:BBa_K2992014 BBa_K2992014]) followed by the FAST protein ([https://parts.igem.org/wiki/index.php?title=Part:BBa_K2992000 BBa_K2992000]) and the T<em>fdx</em> terminator ([https://parts.igem.org/Part:BBa_K2284012 BBa_K2284012]):<br>
     - P<em>botR</em>: [https://parts.igem.org/wiki/index.php?title=Part:BBa_K2992012 BBa_K2992012] <br>

<br>
https://2019.igem.org/wiki/images/5/5e/T--Nottingham--Basic4.png
<br>
https://2019.igem.org/wiki/images/6/6b/T--Nottingham--Basic3.png
<br>
The first observation from the expression of the FAST protein using different <em>Clostridium</em> and <em>E.&nbsp;coli</em> promoters is that FAST is a suitable reporter gene, both in <em>E.&nbsp;coli</em> and in <em>Clostridium&nbsp;sporogenes</em>. Indeed, quantifiable levels of fluorescence were recorded in between 6.3*10<sup>3</sup> MEFL/particle and 1.1*10<sup>6</sup> MEFL/particle. P<em>fdx</em> is the strongest of the promoters tested in <em>E.&nbsp;coli</em> after P<em>thl</em>, and the strongest in <em>C.&nbsp;sporogenes</em>.

<br>

P<em>fdx</em> and Bba_K2715011 have equivalent expression levels (5.5*10<sup>5</sup> +- 0.9*10<sup>5</sup> MEFL/particle and 6*10<sup>5</sup> +-1*10<sup>5</sup> MEFL/particle respectively in <em>C.&nbsp;sporogenes</em>; 9*10<sup>5</sup> +- 1*10<sup>5</sup> 10<sup>5</sup> MEFL/particle and 1.007*10<sup>6</sup> +-0.009*10<sup>6</sup> 10<sup>5</sup> MEFL/particle respectively in <em>E.&nbsp;coli</em>). Statistical equivalence was not significant, but they were not stastically different either (p=0.779 in a two-tailed Welch t-test). In the absence of better data, we consider P<em>fdx</em> and Bba_K2715011 to be interchangeable. Since our part &ldquo;Pfdx&rdquo; is the original, unmutated version of the ferredoxin promoter from <em>C.&nbsp;sporogenes</em>, the sequence of Bba_K2715011 documented in the registry of parts should be curated to match the native sequence of P<em>fdx</em>.

<br>

For more characterisation details, please see the Results page.
<br>
https://2019.igem.org/Team:Nottingham/Results
<br>
<!-- -->
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K2992016 SequenceAndFeatures</partinfo>

===References=== 
Cañadas, I., Groothuis, D., Zygouropoulou, M., Rodrigues, R. and Minton, N. (2019). RiboCas: A Universal CRISPR-Based Editing Tool for Clostridium. ACS Synthetic Biology, 8(6), pp.1379-1390

Minton, N., Ehsaan, M., Humphreys, C., Little, G., Baker, J., Henstra, A., Liew, F., Kelly, M., Sheng, L., Schwarz, K. and Zhang, Y. (2016). A roadmap for gene system development in Clostridium. Anaerobe, 41, pp.104-112.

Zhang, Y., Xu, S., Chai, C., Yang, S., Jiang, W., Minton, N. and Gu, Y. (2016). Development of an inducible transposon system for efficient random mutagenesis inClostridium acetobutylicum. FEMS Microbiology Letters, 363(8), p.fnw065.

<!-- Uncomment this to enable Functional Parameter display 
===Functional Parameters===
<partinfo>BBa_K2992016 parameters</partinfo>
<!-- -->