View source for Part:BBa K823037

__NOTOC__
<partinfo>BBa_K823037 short</partinfo>

10xHis-tag with RBS in [[Help:Assembly_standard_25|Freiburg standard]].


prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

This is a part created by the LMU-Munich 2012 team.  We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

[[Part:BBa_K823034|3x Flag - tag]]

[[Part:BBa_K823035|HA - tag]]

[[Part:BBa_K823036|cMyc - tag]]

[[Part:BBa_K823037|His - tag]]

[[Part:BBa_K823038| Strep - tag]]


Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].



<!-- Add more about the biology of this part here
===Usage and Biology===

<!-- -->
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K823037 SequenceAndFeatures</partinfo>


<!-- Uncomment this to enable Functional Parameter display 
===Functional Parameters===
<partinfo>BBa_K823037 parameters</partinfo>
<!-- -->