Ribosome Binding Sites/Prokaryotic/Regulated/Isaacs
Description
The Isaacs RBS family are a small collection of regulatable prokaryotic Ribosome Binding Sites, or riboregulators, that have been demonstrated to work in E. coli. The family of RBS were derived from work published by Farren Isaacs and coworkers Isaacs. The family members have not yet been quantitatively characterized (see the Characterization section below).
Obtaining Isaacs RBS parts
The sequences of the Isaacs RBS parts can be found in the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the RBS parts are relatively short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligo's and annealed. See here for a tutorial on how to construct short parts via oligo annealing.
Via the Registry distribution: The RBS parts are not currently available from the Registry distribution.
Isaacs RBS family members
| Identifier | Sequencea | Strength |
|---|---|---|
| BBa_J01010 | TCTAGAGAACTAGAATCACCTCTTGGATTTGGGTATTAAAGAGGAGATACTAGATG | |
| BBa_J01080 | TCTAGAGAACTAGAATCACCTCTTGCTTTTGGGTAAGAAAGAGGAGATACTAGATG |
aThe sequence of individual RBS are shown in black and red. The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence. The start codon of the downstream coding sequence is shown in green.
Characterization
References
<biblio>
- Isaacs pmid=15208640
</biblio>