Recombination/Escherichia coli-derived XerCD-dif

< Back to Recombination systems, DNA recombination sites, or Recombinases

XiaonanWangPhoto.jpg Xiaonan Wang, a member of the [http://2007.igem.org/Edinburgh 2007 University of Edinburgh iGEM team], designed the dif recombination sites BBa_I742101 and BBa_I742102.

The following text is excerpted from Ip et al. Ip03. It has been edited for clarity.

The separation and segregation of newly replicated E. coli circular chromosomes can also be prevented by the formation of circular chromosome dimers, which can arise during crossing over by homologous recombination Blakely91; Clerget91; Kuempel91. In E. coli, these dimers, which arise about once every six generations, are resolved to monomers by the action of the FtsK–XerCD–dif chromosome dimer resolution machinery Steiner98a, Steiner98b, Recchia99, Steiner99. Two site-specific recombinases of the tyrosine recombinase family, XerCD, act at a 28 bp recombination site, dif, located in the replication terminus region of the E. coli chromosome to remove the crossover introduced by dimer formation, thereby converting dimers to monomers. A complete dimer resolution reaction during recombination at dif requires the action of the C-terminal domain of FtsK (FtsKC) Steiner99; Barre00. FtsK is a multifunctional protein whose N-terminal domain acts in cell division, while the C-terminal domain functions in chromosome segregation Liu98; Wang98; Yu98a, Yu98b. Therefore, FtsK is well suited to coordinate chromosome segregation and cell division. A purified protein, FtsK50C, containing a functional C-terminal domain, can translocate DNA in an ATP-dependent manner and activate Xer recombination at the recombination site dif, thereby reconstituting in vitro the expected in vivo activities of the C-terminal domain of the complete FtsK protein Aussel02.

Recombination sites


More...
NameDescriptionSequenceRecombinaseLength
BBa_I742101dif site with forward orientation . . . tcggtgcgcataatgtatattatgttaaat 31
BBa_I742102dif site with reverse orientation . . . tcatttaacataatatacattatgcgcacc 31


Recombinases

There are currently no XerCD recombinases available from the Registry.



References

<biblio>

  1. Blakely91 pmid=1931824
  2. Clerget91 pmid=1931823
  3. Kuempel91 pmid=1657123
  4. Steiner98a pmid=9484882
  5. Steiner98b pmid=9829936
  6. Liu98 pmid=9723927
  7. Wang98 pmid=9723913
  8. Yu98a pmid=9495771
  9. Yu98b pmid=9829960
  10. Steiner99 pmid=10027974
  11. Recchia99 pmid=10523315
  12. Barre00 pmid=11114887
  13. Aussel02 pmid=11832210
  14. Ip03 pmid=14633998

</biblio>