Recombination/Bacteriophage P22-derived att

< Back to Recombination systems, DNA recombination sites, or Recombinases

The 2004 Boston University iGEM team designed and constructed the P22 att recombination sites BBa_I11032 and BBa_I11033.

The following text is excerpted from Cho et al. Cho99. It has been edited for clarity.

Bacteriophage P22 is a lambdoid phage which infects Salmonella typhimurium. P22 can integrate into and excise out of its host chromosome via site-specific recombination. Both integration and excision reactions require the phage-encoded int gene Smith67, and excision is dependent on the xis gene as well.

P22 Int is a member of the λ integrase family Argos86, Esposito97, NunesDuby98. The Int proteins of λ and P22 are composed of two domains. The catalytic domain binds to the core region of the phage recombination site, attP, where the actual recombination reactions occur. The smaller amino-terminal domain binds to arm-type sequences which are located on either site of the core within the attP Vargas88, Mungo94. The active components of λ integrative and excisive recombination are nucleosome-like structures, called intasomes, in which DNA is folded around several molecules of Int and integration host factor (IHF) Better82, Griffith85, Pollock83, Richet88, Robertson88. It has been demonstrated that one monomer of λ integrase can simultaneously occupy both a core-type binding site and an arm-type binding site Kim90, MacWilliams96. Formation of these bridges is facilitated by IHF, which binds to specific sequences and imparts a substantial bend to the DNA Craig84, Rice96, Robertson88, Snyder89.

The attP regions of P22 and λ are also similar in that both contain arm regions, known as the P and P′ arms, which contain Int arm-type binding sites and IHF binding sites Leong86, Mungo94. However, the arrangement, spacing, and orientation of the Int and IHF binding sites are distinct Mungo94. The attP region of λ contains two Int arm-type binding sites on the P arm and three on the P′ arm. The P arm contains two IHF binding sites, and the P′ arm contains a single site. The attP region of P22 contains three Int arm-type binding sites on the P arm and two sites on the P′ arm. In addition, IHF binding sites, called H and H′, are located on each arm of the P22 attP. Leong et al. Leong85 showed that the Escherichia coli IHF can recognize and bind to these P22 IHF binding sites in vitro. It was also shown that the maximum amount of P22 integrative recombination occurred in the presence of E. coli IHF in vitro, whereas in its absence, recombination was detectable but depressed Mungo94. However, the requirement for IHF or other possible accessory proteins during P22 site-specific recombination in vivo has not been tested. In this study, we assessed the role of IHF in P22 integration and excision in vivo.

Although the attP region of P22 contains strong IHF binding sites, in vivo measurements of integration and excision frequencies showed that infecting P22 phages can perform site-specific recombination to its maximum efficiency in the absence of IHF. In addition, a plasmid integration assay showed that integrative recombination occurs equally well in wild-type and ihfA mutant cells. P22 integrative recombination is also efficient in Escherichia coli in the absence of functional IHF. These results suggest that nucleoprotein structures proficient for recombination can form in the absence of IHF or that another factor(s) can substitute for IHF in the formation of complexes.

Recombination sites

*More...*
Name	Description	Sequence	Recombinase	Length
BBa_I11032	P22 ''attB'', reverse complement	acgaccttcgcattacgaatgcgctgc		27
BBa_I11033	P22 ''attP''	. . . gggacatatttgggacagaagtaccaaaaa		260

Recombinases

*More...*
Name	Protein	Description	Direction	KEGG	UniProt	E.C.	Recombination site	Length
BBa_I11031	Xis P22	excisionase from E. coli phage P22 (removes prophage from host genome)	Forward	none	P04889	none		412
BBa_I11030	Int P22	integrase from E. coli phage P22	Forward	none	P04890	none		1225

References

Cho99 pmid=10400581
Smith67 Smith, H O; Levine, M. A phage P22 gene controlling integration of prophage. Virology. 1967;31:297–316.
Susskind78 pmid=353481
Leong86 pmid=3491212
Argos86 pmid=3011407
Esposito97 pmid=9278480
NunesDuby98 pmid=9421491
Vargas88 pmid=2843292
Mungo94 pmid=8051182
Better82 pmid=6310548
Griffith85 pmid=3159013
Pollock83 pmid=6226803
Richet88 pmid=2964274
Robertson88 pmid=2831189
Kim90 pmid=2146029
MacWilliams96 pmid=8807282
Craig84 pmid=6096022
Rice96 pmid=8980235
Snyder89 pmid=2528698
Leong85 pmid=2984205

</biblio>