Promoters/Catalog/Yeast/Repressible
All the promoters on this page are yeast promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K950000 | yeast fet3 promotor | . . . cagtgtaaggaagagtagcaaaaaattaga | 575 | 4852 | In stock | ||
| BBa_K950002 | yeast anb1 promotor | . . . atacacctatttcattcacacactaaaaca | 399 | 5683 | In stock | ||
| BBa_K165000 | MET 25 Promoter | . . . tagatacaattctattacccccatccatac | 387 | 6991 | It's complicated | ||
| BBa_K950003 | yeast suc2 promotor | . . . aaaaagcttttcttttcactaacgtatatg | 699 | 5148 | It's complicated | ||
| BBa_K4706002 | PHO5 Promotor (Phosphate repressed) | . . . caaatagagcaagcaaattcgagattacca | 1084 | ||||
| BBa_I766558 | pFig1 (Inducible) Promoter | . . . aaacaaacaaacaaaaaaaaaaaaaaaaaa | 1000 | 2141 | Not in stock | ||
| BBa_I766214 | pGal1 | . . . atactttaacgtcaaggagaaaaaactata | 1002 | 1190 | Not in stock |