Promoters/Catalog/USTC


The 2007 USTC iGEM team.

Description

Members of the USTC logic promoter collection are suitable for performing logical operations at the level of transcription in E. coli and probably other prokaryotes. All members of the promoter collection are repressible, some with one cognate repressor binding site and some with two. By using different combinations of the number and type of repressor binding sites, the USTC iGEM team constructed a collection of promoters with different logic gate behavior, including NOT, NAND and NOR.

Obtaining the USTC logic promoter collection

The sequences of the USTC logic promoters can be found in the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the promoters are relatively short sequences, they can be ordered as two single-stranded overlapping oligo's are annealed and extended to construct the full promoters. See [http://openwetware.org/wiki/Knight:Annealing_and_primer_extension_with_Klenow_polymerase this] OpenWetWare protocol on how to constructing parts via oligo annealing and extension. Alternatively the promoters can be ordered as short genes from a company such as [http://geneart.com Geneart].

Via the Registry distribution: The promoters are not available in the current registry distribution.

Design & Construction

The construction scheme for the USTC logic promoters. All promoters are based on the the lacUV5 promoter. Different operator sequences are added to either side of the base promoter via PCR.

All the promoters are based on the lacUV5 promoter (BBa_I732021) that is a mutant of the wild-type lac promoter.

USTC logic promoter collection


More...
NameDescriptionPromoter SequenceMeasured Strength
BBa_I732200NOT Gate Promoter Family Member (D001O1wt1) . . . gaattgtgagcggataacaattggatccgg 
BBa_I732201NOT Gate Promoter Family Member (D001O11) . . . ggaattgtgagcgctcacaattggatccgg 
BBa_I732202NOT Gate Promoter Family Member (D001O22) . . . ggaattgtaagcgcttacaattggatccgg 
BBa_I732203NOT Gate Promoter Family Member (D001O33) . . . ggaattgtaaacgtttacaattggatccgg 
BBa_I732204NOT Gate Promoter Family Member (D001O44) . . . ggaattgtgaacgttcacaattggatccgg 
BBa_I732205NOT Gate Promoter Family Member (D001O55) . . . ggaattttgagcgctcaaaattggatccgg 
BBa_I732206NOT Gate Promoter Family Member (D001O66) . . . ggaattatgagcgctcataattggatccgg 
BBa_I732207NOT Gate Promoter Family Member (D001O77) . . . gggacgactgtatacagtcgtcggatccgg 
BBa_I732270Promoter Family Member with Hybrid Operator (D001O12) . . . ggaattgtgagcgcttacaattggatccgg 
BBa_I732271Promoter Family Member with Hybrid Operator (D001O16) . . . ggaattgtgagcgctcataattggatccgg 
BBa_I732272Promoter Family Member with Hybrid Operator (D001O17) . . . ggaattgtgagctacagtcgtcggatccgg 
BBa_I732273Promoter Family Member with Hybrid Operator (D001O21) . . . ggaattgtaagcgctcacaattggatccgg 
BBa_I732274Promoter Family Member with Hybrid Operator (D001O24) . . . ggaattgtaagcgttcacaattggatccgg 
BBa_I732275Promoter Family Member with Hybrid Operator (D001O26) . . . ggaattgtaagcgctcataattggatccgg 
BBa_I732276Promoter Family Member with Hybrid Operator (D001O27) . . . ggaattgtaagctacagtcgtcggatccgg 
BBa_I732277Promoter Family Member with Hybrid Operator (D001O46) . . . ggaattgtgaacgctcataattggatccgg 
BBa_I732278Promoter Family Member with Hybrid Operator (D001O47) . . . ggaattgtgaactacagtcgtcggatccgg 
BBa_I732279Promoter Family Member with Hybrid Operator (D001O61) . . . ggaattatgagcgctcacaattggatccgg 
BBa_I732301NAND Candidate (U073O26D001O16) . . . ggaattgtgagcgctcataattggatccgg 
BBa_I732302NAND Candidate (U073O27D001O17) . . . ggaattgtgagctacagtcgtcggatccgg 
BBa_I732303NAND Candidate (U073O22D001O46) . . . ggaattgtgaacgctcataattggatccgg 
BBa_I732304NAND Candidate (U073O22D001O47) . . . ggaattgtgaactacagtcgtcggatccgg 
BBa_I732305NAND Candidate (U073O22D059O46) . . . taaattgtgaacgctcataattggatccgg 
BBa_I732306NAND Candidate (U073O11D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732351NOR Candidate (U037O11D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732352NOR Candidate (U035O44D001O22) . . . ggaattgtaagcgcttacaattggatccgg 
BBa_I732400Promoter Family Member (U097NUL+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732401Promoter Family Member (U097O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732402Promoter Family Member (U085O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732403Promoter Family Member (U073O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732404Promoter Family Member (U061O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732405Promoter Family Member (U049O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732406Promoter Family Member (U037O11+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732407Promoter Family Member (U097NUL+D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732408Promoter Family Member (U097NUL+D014O22) . . . taaattgtaagcgcttacaattggatccgg 
BBa_I732409Promoter Family Member (U097NUL+D026O22) . . . gtaattgtaagcgcttacaattggatccgg 
BBa_I732410Promoter Family Member (U097NUL+D038O22) . . . tcaattgtaagcgcttacaattggatccgg 
BBa_I732411Promoter Family Member (U097NUL+D050O22) . . . aaaattgtaagcgcttacaattggatccgg 
BBa_I732412Promoter Family Member (U097NUL+D062O22) . . . caaattgtaagcgcttacaattggatccgg 
BBa_I732413Promoter Family Member (U097O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732414Promoter Family Member (U097O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg 
BBa_I732415Promoter Family Member (U097O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg 
BBa_I732416Promoter Family Member (U097O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg 
BBa_I732417Promoter Family Member (U097O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg 
BBa_I732418Promoter Family Member (U097O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg 
BBa_I732419Promoter Family Member (U085O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732420Promoter Family Member (U085O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg 
BBa_I732421Promoter Family Member (U085O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg 
BBa_I732422Promoter Family Member (U085O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg 
BBa_I732423Promoter Family Member (U085O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg 
BBa_I732424Promoter Family Member (U085O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg 
BBa_I732425Promoter Family Member (U073O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732426Promoter Family Member (U073O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg 
BBa_I732427Promoter Family Member (U073O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg 
BBa_I732428Promoter Family Member (U073O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg 
BBa_I732429Promoter Family Member (U073O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg 
BBa_I732430Promoter Family Member (U073O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg 
BBa_I732431Promoter Family Member (U061O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732432Promoter Family Member (U061O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg 
BBa_I732433Promoter Family Member (U061O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg 
BBa_I732434Promoter Family Member (U061O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg 
BBa_I732435Promoter Family Member (U061O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg 
BBa_I732436Promoter Family Member (U061O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg 
BBa_I732437Promoter Family Member (U049O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732438Promoter Family Member (U049O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg 
BBa_I732439Promoter Family Member (U049O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg 
BBa_I732440Promoter Family Member (U049O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg 
BBa_I732441Promoter Family Member (U049O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg 
BBa_I732442Promoter Family Member (U049O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg 
BBa_I732443Promoter Family Member (U037O11+D002O22) . . . gaaattgtaagcgcttacaattggatccgg 
BBa_I732444Promoter Family Member (U037O11+D014O22) . . . taaattgtaagcgcttacaattggatccgg 
BBa_I732445Promoter Family Member (U037O11+D026O22) . . . gtaattgtaagcgcttacaattggatccgg 
BBa_I732446Promoter Family Member (U037O11+D038O22) . . . tcaattgtaagcgcttacaattggatccgg 
BBa_I732447Promoter Family Member (U037O11+D050O22) . . . aaaattgtaagcgcttacaattggatccgg 
BBa_I732448Promoter Family Member (U037O11+D062O22) . . . caaattgtaagcgcttacaattggatccgg 
BBa_I732450Promoter Family Member (U073O26+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732451Promoter Family Member (U073O27+D062NUL) . . . gccaaattaaacaggattaacaggatccgg 
BBa_I732452Promoter Family Member (U073O26+D062O61) . . . caaattatgagcgctcacaattggatccgg 

Characterization


Measured strengths