Promoters/Catalog/USTC
Description
Members of the USTC logic promoter collection are suitable for performing logical operations at the level of transcription in E. coli and probably other prokaryotes. All members of the promoter collection are repressible, some with one cognate repressor binding site and some with two. By using different combinations of the number and type of repressor binding sites, the USTC iGEM team constructed a collection of promoters with different logic gate behavior, including NOT, NAND and NOR.
Obtaining the USTC logic promoter collection
The sequences of the USTC logic promoters can be found in the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the promoters are relatively short sequences, they can be ordered as two single-stranded overlapping oligo's are annealed and extended to construct the full promoters. See [http://openwetware.org/wiki/Knight:Annealing_and_primer_extension_with_Klenow_polymerase this] OpenWetWare protocol on how to constructing parts via oligo annealing and extension. Alternatively the promoters can be ordered as short genes from a company such as [http://geneart.com Geneart].
Via the Registry distribution: The promoters are not available in the current registry distribution.
Design & Construction
All the promoters are based on the lacUV5 promoter (BBa_I732021) that is a mutant of the wild-type lac promoter.
USTC logic promoter collection
Name | Description | Promoter Sequence | Measured Strength |
---|---|---|---|
BBa_I732200 | NOT Gate Promoter Family Member (D001O1wt1) | . . . gaattgtgagcggataacaattggatccgg | |
BBa_I732201 | NOT Gate Promoter Family Member (D001O11) | . . . ggaattgtgagcgctcacaattggatccgg | |
BBa_I732202 | NOT Gate Promoter Family Member (D001O22) | . . . ggaattgtaagcgcttacaattggatccgg | |
BBa_I732203 | NOT Gate Promoter Family Member (D001O33) | . . . ggaattgtaaacgtttacaattggatccgg | |
BBa_I732204 | NOT Gate Promoter Family Member (D001O44) | . . . ggaattgtgaacgttcacaattggatccgg | |
BBa_I732205 | NOT Gate Promoter Family Member (D001O55) | . . . ggaattttgagcgctcaaaattggatccgg | |
BBa_I732206 | NOT Gate Promoter Family Member (D001O66) | . . . ggaattatgagcgctcataattggatccgg | |
BBa_I732207 | NOT Gate Promoter Family Member (D001O77) | . . . gggacgactgtatacagtcgtcggatccgg | |
BBa_I732270 | Promoter Family Member with Hybrid Operator (D001O12) | . . . ggaattgtgagcgcttacaattggatccgg | |
BBa_I732271 | Promoter Family Member with Hybrid Operator (D001O16) | . . . ggaattgtgagcgctcataattggatccgg | |
BBa_I732272 | Promoter Family Member with Hybrid Operator (D001O17) | . . . ggaattgtgagctacagtcgtcggatccgg | |
BBa_I732273 | Promoter Family Member with Hybrid Operator (D001O21) | . . . ggaattgtaagcgctcacaattggatccgg | |
BBa_I732274 | Promoter Family Member with Hybrid Operator (D001O24) | . . . ggaattgtaagcgttcacaattggatccgg | |
BBa_I732275 | Promoter Family Member with Hybrid Operator (D001O26) | . . . ggaattgtaagcgctcataattggatccgg | |
BBa_I732276 | Promoter Family Member with Hybrid Operator (D001O27) | . . . ggaattgtaagctacagtcgtcggatccgg | |
BBa_I732277 | Promoter Family Member with Hybrid Operator (D001O46) | . . . ggaattgtgaacgctcataattggatccgg | |
BBa_I732278 | Promoter Family Member with Hybrid Operator (D001O47) | . . . ggaattgtgaactacagtcgtcggatccgg | |
BBa_I732279 | Promoter Family Member with Hybrid Operator (D001O61) | . . . ggaattatgagcgctcacaattggatccgg | |
BBa_I732301 | NAND Candidate (U073O26D001O16) | . . . ggaattgtgagcgctcataattggatccgg | |
BBa_I732302 | NAND Candidate (U073O27D001O17) | . . . ggaattgtgagctacagtcgtcggatccgg | |
BBa_I732303 | NAND Candidate (U073O22D001O46) | . . . ggaattgtgaacgctcataattggatccgg | |
BBa_I732304 | NAND Candidate (U073O22D001O47) | . . . ggaattgtgaactacagtcgtcggatccgg | |
BBa_I732305 | NAND Candidate (U073O22D059O46) | . . . taaattgtgaacgctcataattggatccgg | |
BBa_I732306 | NAND Candidate (U073O11D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732351 | NOR Candidate (U037O11D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732352 | NOR Candidate (U035O44D001O22) | . . . ggaattgtaagcgcttacaattggatccgg | |
BBa_I732400 | Promoter Family Member (U097NUL+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732401 | Promoter Family Member (U097O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732402 | Promoter Family Member (U085O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732403 | Promoter Family Member (U073O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732404 | Promoter Family Member (U061O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732405 | Promoter Family Member (U049O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732406 | Promoter Family Member (U037O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732407 | Promoter Family Member (U097NUL+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732408 | Promoter Family Member (U097NUL+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | |
BBa_I732409 | Promoter Family Member (U097NUL+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | |
BBa_I732410 | Promoter Family Member (U097NUL+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | |
BBa_I732411 | Promoter Family Member (U097NUL+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | |
BBa_I732412 | Promoter Family Member (U097NUL+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | |
BBa_I732413 | Promoter Family Member (U097O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732414 | Promoter Family Member (U097O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | |
BBa_I732415 | Promoter Family Member (U097O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | |
BBa_I732416 | Promoter Family Member (U097O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | |
BBa_I732417 | Promoter Family Member (U097O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | |
BBa_I732418 | Promoter Family Member (U097O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | |
BBa_I732419 | Promoter Family Member (U085O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732420 | Promoter Family Member (U085O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | |
BBa_I732421 | Promoter Family Member (U085O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | |
BBa_I732422 | Promoter Family Member (U085O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | |
BBa_I732423 | Promoter Family Member (U085O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | |
BBa_I732424 | Promoter Family Member (U085O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | |
BBa_I732425 | Promoter Family Member (U073O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732426 | Promoter Family Member (U073O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | |
BBa_I732427 | Promoter Family Member (U073O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | |
BBa_I732428 | Promoter Family Member (U073O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | |
BBa_I732429 | Promoter Family Member (U073O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | |
BBa_I732430 | Promoter Family Member (U073O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | |
BBa_I732431 | Promoter Family Member (U061O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732432 | Promoter Family Member (U061O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | |
BBa_I732433 | Promoter Family Member (U061O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | |
BBa_I732434 | Promoter Family Member (U061O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | |
BBa_I732435 | Promoter Family Member (U061O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | |
BBa_I732436 | Promoter Family Member (U061O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | |
BBa_I732437 | Promoter Family Member (U049O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732438 | Promoter Family Member (U049O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | |
BBa_I732439 | Promoter Family Member (U049O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | |
BBa_I732440 | Promoter Family Member (U049O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | |
BBa_I732441 | Promoter Family Member (U049O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | |
BBa_I732442 | Promoter Family Member (U049O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | |
BBa_I732443 | Promoter Family Member (U037O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | |
BBa_I732444 | Promoter Family Member (U037O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | |
BBa_I732445 | Promoter Family Member (U037O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | |
BBa_I732446 | Promoter Family Member (U037O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | |
BBa_I732447 | Promoter Family Member (U037O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | |
BBa_I732448 | Promoter Family Member (U037O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | |
BBa_I732450 | Promoter Family Member (U073O26+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732451 | Promoter Family Member (U073O27+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | |
BBa_I732452 | Promoter Family Member (U073O26+D062O61) | . . . caaattatgagcgctcacaattggatccgg |
Characterization