Promoters/Catalog/T7/Repressible
All the promoters on this page are recognized by the T7 RNA Polymerase and are negatively regulated meaning that increased levels of at least one transcription factor will decrease the activity of these promoters. T7 promoters are known to have high activity levels and are also highly orthogonal to bacterial promoters since the respective RNA Polymerases are unrelated.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K921000 | T7 RNAP + IPTG->PoPs (Mutant I) | . . . aggacaattgtgggcggacaacaattccaa | 46 | 6465 | In stock | ||
| BBa_K921001 | T7 RNAP + IPTG->PoPs (Mutant II) | . . . ggcggaattgtgagcggataacaattccaa | 48 | 6782 | It's complicated | ||
| BBa_K921002 | T7 RNAP + IPTG->PoPs (Mutant III) | . . . gagagaattgtgagcggataacaattccaa | 47 | 6400 | In stock | ||
| BBa_R0184 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1176 | Not in stock | ||
| BBa_R0185 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1888 | Not in stock | ||
| BBa_R0186 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1885 | Not in stock | ||
| BBa_R0187 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1885 | Not in stock |