Part:BBa_K5195001:Design

Design: To integrate the fragment into our DBD backbone, we added overhangs to the sequence via PCR. We considered making a shorter isoform of DUX4-DBD (157 amino acids, which includes only the two homeodomains) and attaching a KRAB repressor to this sequence. Our team only cloned the original design since DBD 157 proved to not have much change to the competitive properties of our initial DBD.

Primers for integration of the KRAB fragment into the backbone included Forward - 5' ggaagaaccttggctggtatgaaagggcgaattcgatatcaagcttatcgatac 3' Reverse - 5' gtccttgaacgtaaccagtgttctggcaggtgcagccctagctg 3'

Characterization: Part characterization for the KRAB domain was performed using its composite part (KRAB fused to DUX4-DBD and linked to a mNeonGreen fluorophore). Please refer to that part page for more details.

[1] Margolin, J. F., Friedman, J., Meyer, E. K.-H., Vissing, H., & Thiesen, H.-J. (1994, January 31). Kruppel-associated boxes are potent transcriptional repression domains. National Library of Medicine | National Center for Biotechnology Information. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC43815/pdf/pnas01132-0416.pdf [2] Himeda, C. L., Jones, T. I., Virbasius, C.-M., Zhu, L. J., Green, M. R., & Jones, P. L. (2018). Identification of epigenetic regulators of DUX4-FL for targeted therapy of facioscapulohumeral muscular dystrophy. Molecular Therapy, 26(7), 1797–1807. https://doi.org/10.1016/j.ymthe.2018.04.019 [3] Kearns, N. A., Genga, R. M., Enuameh, M. S., Garber, M., Wolfe, S. A., & Maehr, R. (2014). Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development, 141(1), 219–223. https://doi.org/10.1242/dev.103341