Coding
Part:BBa_K4769207:Design
Designed by: Kieran Abbott Group: iGEM23_Cambridge (2023-10-10)
eps operon coding sequence from B. subtilis 3610
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 2173
Illegal PstI site found at 410
Illegal PstI site found at 1519
Illegal PstI site found at 1868 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 2173
Illegal PstI site found at 410
Illegal PstI site found at 1519
Illegal PstI site found at 1868 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 2173
Illegal BglII site found at 1580 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 2173
Illegal PstI site found at 410
Illegal PstI site found at 1519
Illegal PstI site found at 1868 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 2173
Illegal PstI site found at 410
Illegal PstI site found at 1519
Illegal PstI site found at 1868 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 1357
Illegal SapI.rc site found at 1525
Design Notes
N/A
Source
B. subtilis 3610 genome
Primers for cloning: FW: atgaatgagaatatgagtttcaaagaattatatgc (+ desired overhangs) RV: gtctactttttctgtaatgctgtctg (+ desired overhangs)