Coding
Part:BBa_K4769205:Design
Designed by: Kieran Abbott Group: iGEM23_Cambridge (2023-10-10)
yqxM-sipW-tasA operon coding sequence from B. subtilis 3610
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1531
Illegal PstI site found at 1419 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1531
Illegal PstI site found at 1419 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1531
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1531
Illegal PstI site found at 1419 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1531
Illegal PstI site found at 1419
Illegal NgoMIV site found at 841
Illegal NgoMIV site found at 1142 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 448
Illegal BsaI.rc site found at 1032
Design Notes
N/A
Source
B. subtilis 3610 genome
Primers for cloning: FW: atgtttcgattgtttcacaatcagc (+ desired overhangs) RV: ttaatttttatcctcgctatgcgc (+ desired overhangs)