Part:BBa_K091103:Design

Duplicate of BBa_I715052

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Design Notes

Mode of action of the E. coli trp operon anti-terminator. The position of the ribosome on the mRNA molecule, while both transcription and translation occur in tandem, affects the mRNA tertiary structure and decides between the formation of the anti-terminator or the terminator. A: If the anti-terminator forms, shown by the pairing of regions 2 and 3, then the terminator cannot form, and transcription continues. B: If the anti-terminator does not form, then the terminator will form by pairing regions 3 and 4, and transcription will stop.

Two possible mRNA tertiary conformations, in either the presence (A) or absence (B) of tryptophan. Although transcription of the trp operon has not finished, translation of the nascent mRNA strand begins. Depending on the levels of tryptophan, the elongating mRNA can take on two different conformations. A: The conformation of the trp operon mRNA under normal conditions, when tryptophan is abundant. The transcription-pause loop, shown in yellow, pauses the RNA polymerase and allows the ribosome to catch up, synchronizing transcription and translation. The ribosome does not stall at the tandem tryptophan codons, and the anti-terminator cannot form. The transcriptional terminator does form, and transcription ends. B: Under tryptophan-starved conditions, the conformation of the mRNA is noticeably different. Again, transcription and translation are synchronized due to the presence of the pause stem-loop. However, the ribosome stalls at the tandem tryptophan codons because it is waiting for tRNATrp, which are now rare. Meanwhile, RNA polymerase moves further ahead. The anti-terminator then forms and prevents the downstream terminator from forming. Transcription does not end, and the entire trp operon is transcribed.

Source

It was amplified by PCR using these primers: DNA sequence of forward primer: 5' GCATGAATTCGCGGCCGCTTCTAGACGTAAAAAGGGTATCGACAATGAAA 3' DNA sequence or reverse primer: 5' GCATCTGCAGCGGCCGCAACTAGTAAAAAAAAGCCCGCTCATTAGG 3'

The primers contain the BioBrick ends, as well as 4 extra bases to facilitate restriction enzyme digestion and subsequent cloning. Template was genomic DNA from JM109.

References

• Landick, Robert, Jannette Carey, and Charles Yanofsky. 1985. “Translation Activates the Paused Transcription Complex and Restores Transcription of the trp Operon Leader Region.” Proceedings of the National Academy of Sciences of the United States of America 82(14), 4663-4667.
• Landick, Robert, Jannette Carey, and Charles Yanofsky. 1987. “Detection of Transcription-Pausing in vivo in the trp Operon Leader Region.” Proceedings of the National Academy of Sciences of the United States of America 84(6), 1507-1511.
• Nudler, E. and M. E. Gottesman. 2002. “Transcription termination and anti-termination in E. coli.” Genes to Cells 7, 755-768.