Help:Production/2011 Plasmid Backbone Production
Batch Summary
| Plasmid | Batch # | Date | Notes |
|---|---|---|---|
| pSB1C3 | 001 | 5/9/11 | |
| pSB1A3 | 001 | 5/9/11 | |
| pSB1K3 | 001 | 5/10/11 | |
| pSB1T3 | 001 | 5/10/11 | |
| pSB1C3 | 002 | 5/24/11 |
Issues with Original Protocol
When testing out the original protocol for bulk production we found that some wells on the PCR plate contained product and others did not. Initially we thought the problem was an issue with denaturing time or temperature and the ability of the thermocycler and opticon to evenly heat a full 96 well plate. We conducted a variety of experiments with different protocol to test this possibility, with no success.
After looking at the sequence pages on the Registry for pSB1A3, pSB1C3, pSB1K3, and pSB1T3 the problem was determined as a sequence issue. The sequence of the plasmids had an ac deletion marked on their Sequence and Features page, however the deletion was never formally edited out of the sequence.
Original Primers (incorrect)
gccgctgcagtccggcaaaaaaacg,SB-prep-3P (Suffix) atgaattccagaaatcatccttagcg,SB-prep-2Ea (Prefix)
The original primers still had the ac, so annealing efficiency was greatly reduced, which explains why some wells showed product and others did not. We created a series of primers and tested them with a variety of success. We determined the one below worked the best, and proceeded with production of the plasmid backbones.
New Primers
gccgctgcagtccggcaaaaaa,SB-prep-3P-1 atgaattccagaaatcatccttagcg,SB-prep-2Ea
The protocol for creating plasmid backbones has been updated to reflect all of the changes and corrections made to the original.
Quality Control
Gel Runs
After each completed PCR run we tested the product in each well on a gel.
- Created dilution plate (96 wells) with 19ul of dH20 in each well
- Added 1ul of PCR Product to each well, using multi-channel pipette
- Loaded all 20ul into two 48 lane E-gels, following our standard loading pattern
- Loaded 20ul of NEB 2-log ladder (1:100 dilution) into all four ladder lanes
- Ran E-gels for 24min
- Imaged according to standard parameters
Gel Results
pSB1C3
pSB1A3
pSB1K3
pSB1T3
Nanodrop Tests
Once we determined that product was standard across all wells through the gel run, we purified the PCR product with a Promega Wizard SV 96 Kit. Note: We found yields to be around 40ng/ul after purification at a total volume of about 70ul (Eluted with 50ul twice, but not all elution passes through)
- After purification tested six wells on Nanodrop: 1D, 3A, 6D, 9H, 12D, 12H
- Combined contents of all wells into 15ml tube
- Nanodropped combined product three times and averaged
- Adjusted to 25ng/ul with TE
- Nanodropped adjusted product three times and averaged
Digest and Ligation Tests
Results from the digest and ligation tests completed for the 2011 Linearized Plasmid Backbones. Tests were for pSB1C3, pSB1A3, pSB1K3, pSB1T3 and pSB1C3 from 2010 (Tom's pSB1C3). See: Digest and Ligation Test Protocol
Notes:
- Cutting with PstI and ligating is more efficient then cutting with EcoRI and ligating. For the former, double band quantity appears greater than single band quantity. Whereas for the latter, the reverse is true.
- pSB1C3 from 2011 appears to be just as efficient if not more so than the pSB1C3 from 2010 (may have degraded over time)
Transformation test
- Transform 1 ul of the diluted final product into highly competent cells
- Control transform 10 pg of pUC19
- Plate on the appropriate antibiotic
- Observe few colonies. Any colonies represent background to the three antibiotic assembly process
- Quantify the effective amount of remaining circular DNA able to transform