DNA/Transposon

< Back to DNA parts

Transposons are sequences of DNA that can move around to different positions within the genome of a single cell. Together with transposases, transposons make up transposomes. Transposomes are frequently used to construct gene knockouts in living cells which can be helpful for identifying essential genes.

TomKnightPhoto.jpg Tom Knight, from MIT CSAIL, designed and constructed two of the transposon parts listed below.
JCA Photo.png
Chris Anderson, a professor of bioengineering at UC Berkeley, designed and constructed two of the transposon parts listed below.


More...
NameDescriptionSequenceLength
BBa_J61021[Tn5-for]ctgtctcttatacacatct19
BBa_J61022[Tn5-rev]agatgtgtataagagacag19
BBa_K1973006miniTn7BB-Gm-nahR-Psal-lapG . . . gggttcccggccgagccggtttactaataa6106
BBa_K510000pUC18Sfi-miniTn7BB-Gm . . . gatttctggaattcgcggccgcttctagag4388
BBa_M1000Left mosaic end for Tn5 transpososomecagctgtctcttatacacatct22
BBa_M1001Right mosaic end for Tn5 transpososomeagatgtgtataagagacagctg22


References

Given the huge number of articles available on transposons, we've included only review articles here. <biblio>

  1. Suzuki pmid=18491037
  2. Maloy pmid=17352910
  3. Kirby pmid=17352911
  4. Haniford pmid=17092825

</biblio>