DNA/Transposon
Transposons are sequences of DNA that can move around to different positions within the genome of a single cell. Together with transposases, transposons make up transposomes. Transposomes are frequently used to construct gene knockouts in living cells which can be helpful for identifying essential genes.
|
Tom Knight, from MIT CSAIL, designed and constructed two of the transposon parts listed below. |  |
Chris Anderson, a professor of bioengineering at UC Berkeley, designed and constructed two of the transposon parts listed below. |
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_J61021 | [Tn5-for] | ctgtctcttatacacatct | 19 |
| BBa_J61022 | [Tn5-rev] | agatgtgtataagagacag | 19 |
| BBa_K1973006 | miniTn7BB-Gm-nahR-Psal-lapG | . . . gggttcccggccgagccggtttactaataa | 6106 |
| BBa_K4235002 | pFastBac-Htb_miniTn7 | . . . acgcttatttgcagcctgaatggcgaatgg | 4956 |
| BBa_K4235010 | mini-attTn7 segment: Tn7R+GmR circuit+Polyhedrin+PROS1+SV40+Tn7L | . . . cccagttcccaactattttgtccgcccaca | 3224 |
| BBa_K4235026 | Tn7R: Right end of the Tn7 transposon segment | . . . gtggccaagggcatggtaaagactatattc | 225 |
| BBa_K4235027 | Tn7L: Left end of the Tn7 transposon segment | . . . cccagttcccaactattttgtccgcccaca | 166 |
| BBa_K510000 | pUC18Sfi-miniTn7BB-Gm | . . . gatttctggaattcgcggccgcttctagag | 4388 |
| BBa_M1000 | Left mosaic end for Tn5 transpososome | cagctgtctcttatacacatct | 22 |
| BBa_M1001 | Right mosaic end for Tn5 transpososome | agatgtgtataagagacagctg | 22 |
References
Given the huge number of articles available on transposons, we've included only review articles here. <biblio>
- Suzuki pmid=18491037
- Maloy pmid=17352910
- Kirby pmid=17352911
- Haniford pmid=17092825
</biblio>