DNA/Spacers
Sometimes it is helpful to physically separate parts on the DNA. In such cases, spacer BioBrick parts that contain (hopefully) innocuous sequences are used.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0040 | Spacer.1 (generic) | . . . cttacctcttaagaggtcactgacctaaca | 70 |
| BBa_K2483005 | sgRNA target site couples facing each other with 6 bp spacer | . . . cgtctgtaatcgccctttgtacgtgaacgg | 850 |
| BBa_K2483006 | sgRNA target site couples facing each other with 18 bp spacer | . . . ttgaccgcggtcttcctccacattcctgtc | 955 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K3831010 | Spacer_0 | . . . cttactctgttgaaaacgaatagataggtt | 40 |
| BBa_K3831011 | Spacer_1 | tgctcgtagtttacc | 15 |
| BBa_K3831012 | Spacer_5 | . . . agaatagtcaatcttcggaaatcccaggtg | 40 |
| BBa_K3831015 | Spacer_7 | taataaaaggtcccg | 15 |
| BBa_K3831023 | Spacer 03 | aaggaacggttattt | 15 |
| BBa_K3831026 | Spacer 02 | agattactactgata | 15 |
| BBa_K3831027 | Spacer 06 | ccgattctgagacgg | 15 |
| BBa_K3831028 | Spacer 04 | . . . aatacaggacccgaatcgtttcagttgcct | 40 |
| BBa_K3831038 | Spacer_SP1 | . . . ttaccacggatacagacagtgataatctta | 40 |