Recombination/Escherichia coli-derived FimBE-fimS
< Back to Recombination systems, DNA recombination sites, or Recombinases
The following is adapted from Holden et al. Holden.
The fim switch (fimS) consists of a 314 bp DNA element that can be inverted by site-specific recombinases FimB and FimE Abraham. In the natural system, fimS contains a promoter, that when switched to the on orientation, drives transcription of the fim operon. The fim operon is needed for export and structural assembly of type 1 fimbriae. FimB and FimE, required to invert fimS, are members of the λ integrase family of site-specific recombinases. Recombination of fimS is distinct from the related Xer-mediated recombination in that the recombinases act independently to invert fimS. Each inverted repeat (IR) is flanked by overlapping FimB and FimE binding sites, and following occupancy of these sites they recombine the switch within the IR sequence. As for λ phage chromosomal integration and excision, fim recombination also requires accessory proteins, specifically integration host factor (IHF) and the leucine-responsive regulatory protein (Lrp). These proteins are believed to contribute to the overall architecture of the fim switch that facilitates synapse of the 9 bp IRs.
FimB catalyses inversion in both directions, although with a slight bias for the off-to-on orientation, while FimE predominantly catalyses on-to-off inversion. Control of FimE expression is important in bringing about its orientation bias Kulasekara; as the fim switch is located at the end of fimE, the orientation of fimS determines the length and 3' sequence of the fimE transcript Hinde, Sohanpal. As a consequence, fimE mRNA is likely to be subject to more rapid 3' to 5' degradation when the switch is in the off orientation than when it is in the on orientation. In addition, FimE preferentially binds to fimS in the on orientation, as has been demonstrated in vitro and in vivo Kulasekara, which adds to the directional bias. A further difference between FimB and FimE is that FimB inversion frequencies are markedly lower than those exhibited by FimE, both in vitro and in vivo Blomfield, Gally.
|
Allen Lin, a member of the [http://2008.igem.org/Team:Caltech 2008 Caltech iGEM team], designed the fim recombination sites BBa_K137008 and BBa_K137010. |
Recombination sites
| Name | Description | Sequence | Recombinase | Length |
|---|---|---|---|---|
| BBa_K137008 | fimE IRR | . . . gaaacatttggggccaaactgtccatatta | 35 | |
| BBa_K137010 | fimE IRL | . . . gagtcaaaatggccccaattgtcttgtatt | 35 |
Recombinases
| Name | Protein | Description | Direction | KEGG | UniProt | E.C. | Recombination site | Length |
|---|---|---|---|---|---|---|---|---|
| BBa_K137007 | fimE | 558 |
Composite parts
| Name | Type | Description | Length | Status |
|---|---|---|---|---|
| BBa_K1632007 | Composite | fim switch[default ON](wild-type)_rbs_gfp | 1128 | It's complicated |
| BBa_K137057 | Device | GFP fimE switch with 150 bp tetR promoter | 1119 | It's complicated |
| BBa_K137058 | Device | GFP fimE switch with 250 bp tetR promoter | 1219 | In stock |
| BBa_K137059 | Device | GFP fimE switch with 350 bp tetR promoter | 1319 | It's complicated |
| BBa_K137060 | Device | GFP fimE switch with 450 bp tetR promoter | 1419 | It's complicated |
| BBa_K137061 | Device | GFP fimE switch with 650 bp tetR promoter | 1619 | It's complicated |
| BBa_K137062 | Device | GFP fimE switch with 850 bp tetR promoter | 1819 | It's complicated |
References
<biblio>
- Holden pmid=18048927
- Kulaskera pmid=10096084
- Hinde pmid=16321930
- Sohanpal pmid=11703669
- Blomfield pmid=1679429
- Gally pmid=8104927
- Abraham pmid=2863818
</biblio>