DNA/Origami

< Back to DNA parts

DNA offers an attractive material for constructing nanostructures. In particular, the high specificity of Watson-Crick base pairing allows a diverse set of binding interactions to occur in parallel in a reasonably predictable fashion Watson. Several groups have leveraged this feature of DNA to construct both two-dimensional sheets and three-dimensional structures Seeman, Shih. In 2006, Rothemund built upon previous work to demonstrate a general method for fabricating DNA into any two dimensional shape Rothemund. His algorithm generates short synthetic DNA staples that direct the folding of a long single-stranded DNA molecule (cloning vector M13 mp18) into arbitrary shapes.

Andrei Kouznetsov, from the [http://2006.igem.org/Freiburg_University_2006 2006 Albert-Ludwigs-University, Freiburg iGEM team], designed most of the DNA origami parts available via the Registry. He derived these DNA origami parts from various published works (see part pages for references). The [http://2008.igem.org/Team:Freiburg 2008 Albert-Ludwigs-University, Freiburg iGEM team] also undertook a project involving DNA origami.

More...

Name	Description	Sequence	Length
BBa_J35000	Rothemund DNA origami part	tcctcttttgaggaacaagttttcttgt	28
BBa_J35001	fork hairpin	. . . ccgcagttttctgcctcgttttcgaggggc	32
BBa_J35002	dumbbell hairpin	gcctcttttgaggcgcaagttttcttgc	28
BBa_J35003	3-fingers arm	. . . gcctcgttttcgagggagttttctccgggc	44
BBa_J35004	4-fingers arm	. . . gagttttctcctctggttttccagtcggcg	63
BBa_J35005	5-fingers arm	. . . gagttttctcctctggttttccagtcggcg	76
BBa_J35006	6-fingers arm	. . . gagttttctcctctggttttccagtcggcg	89
BBa_J35007	7-fingers arm	. . . gagttttctcctctggttttccagtcggcg	102
BBa_J35120	B-Z DNA switcher	tggacactaagctattcatc	20
BBa_K1479005	-- No description --	aattccggaattccgg	16

References

<biblio>

1. Watson pmid=13054692
2. Seeman pmid=12540916
3. Shih pmid=14961116
4. Mao pmid=9923675
5. Rothemund pmid=16541064
6. Smith pmid=16541053

</biblio>