Collections/iGEM Type IIS Collections
Team Uppsala 2020's iGEM Type IIS Standard collection
Until very recently, the main assembly standard supported by the iGEM registry was the BioBrick standard RFC[10]. However, iGEM Type IIS RFC[1000] assembly was recently accepted as a registry standard, and multiple Type IIS backbones and parts were present in the 2019 DNA distribution kit. We strongly believe in the efficiency and power of this cloning method since it can assemble multiple parts in one reaction, and we wanted to contribute to the development of this standard so that it can be used comfortably by the iGEM community.
Our parts collection provides four types of Type IIS parts.
- New backbones: Improved version of pEven Level 2 backbones, along with new pOdd backbones of medium (10-12) and low (~5) copy number for Level 3 assemblies.
- Templates: Parts which have no biological function, but are instead easy to use blueprints to design Type IIS-compatible parts.
- Dummy parts: Placeholders when your planned assembly has less than four parts, the amount needed for iGEM Type IIS reactions.
- RBS: commonly used RBS from the registry which are tailored specifically for iGEM Type IIS assembly.
Additionally to this part collection, we compiled all our design and experimental experiences in an iGEM Type IIS standard guidebook. Check it out here!.
Sequencing files of all the parts can be downloaded here.
Plasmid Backbones
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K3425001 | pSB3C11: Improved pEven1 Loop Vector based on pSB3C01 | Plasmid_Backbone | Nria Garriga Alonso | 2729 | -1 | . . . cccttagtgactcgaattcggtctcaggag |
| BBa_K3425002 | pSB3C12: Improved pEven2 Loop Vector based on pSB3C02 | Plasmid_Backbone | Nria Garriga Alonso | 2729 | -1 | . . . cccttagtgactcgaattcggtctcatact |
| BBa_K3425003 | pSB3C13: Improved pEven3 Loop Vector based on pSB3C03 | Plasmid_Backbone | Nria Garriga Alonso | 2729 | -1 | . . . cccttagtgactcgaattcggtctcaaatg |
| BBa_K3425004 | pSB3C14: Improved pEven4 Loop Vector based on pSB3C04 | Plasmid_Backbone | Nria Garriga Alonso | 2729 | -1 | . . . cccttagtgactcgaattcggtctcagctt |
| BBa_K3425005 | pSB3K01: pOdd1 Loop Vector based on pSB3K3 | Plasmid_Backbone | Nria Garriga Alonso | 2739 | -1 | . . . aggatgatttctggaattcgctcttcaatg |
| BBa_K3425006 | pSB3K02: pOdd2 Loop Vector based on pSB3K3 | Plasmid_Backbone | Nria Garriga Alonso | 2739 | -1 | . . . aggatgatttctggaattcgctcttcagca |
| BBa_K3425008 | pSB3K04: pOdd4 Loop Vector based on pSB3K3 | Plasmid_Backbone | Nria Garriga Alonso | 2739 | -1 | . . . aggatgatttctggaattcgctcttcacag |
| BBa_K3425009 | pSB4K01: pOdd1 Loop Vector based on pSB4K5 | Plasmid_Backbone | Nria Garriga Alonso | 3444 | -1 | . . . aggatgatttctggaattcgctcttcaatg |
| BBa_K3425010 | pSB4K02: pOdd2 Loop Vector based on pSB4K5 | Plasmid_Backbone | Nria Garriga Alonso | 3444 | -1 | . . . aggatgatttctggaattcgctcttcagca |
| BBa_K3425011 | pSB4K03: pOdd3 Loop Vector based on pSB4K5 | Plasmid_Backbone | Nria Garriga Alonso | 3444 | -1 | . . . aggatgatttctggaattcgctcttcatac |
| BBa_K3425012 | pSB4K04: pOdd4 Loop Vector based on pSB4K5 | Plasmid_Backbone | Nria Garriga Alonso | 3444 | -1 | . . . aggatgatttctggaattcgctcttcacag |
| BBa_K3425013 | pSB4A01: pOdd1 Loop Vector based on pSB4A5 | Plasmid_Backbone | Nria Garriga Alonso | 3420 | -1 | . . . aggatgatttctggaattcgctcttcaatg |
| BBa_K3425014 | pSB4A02: pOdd2 Loop Vector based on pSB4A5 | Plasmid_Backbone | Nria Garriga Alonso | 3420 | -1 | . . . aggatgatttctggaattcgctcttcagca |
| BBa_K3425015 | pSB4A03: pOdd3 Loop Vector based on pSB4A5 | Plasmid_Backbone | Nria Garriga Alonso | 3420 | -1 | . . . aggatgatttctggaattcgctcttcatac |
| BBa_K3425016 | pSB4A04: pOdd4 Loop Vector based on pSB4A5 | Plasmid_Backbone | Nria Garriga Alonso | 3420 | -1 | . . . aggatgatttctggaattcgctcttcacag |
Templates
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K3425017 | iGEM Type IIS standard promoter template | Other | Nria Garriga Alonso, Bjrn Ancker Persson, Tereza Hubackova, Dorottya Marko, Hui Yu | 49 | -1 | . . . aaaaaaaaaatactcgagagaagagcgtaa |
| BBa_K3425018 | iGEM Type IIS standard RBS template | Other | Nria Garriga Alonso, Bjrn Ancker Persson, Tereza Hubčkov, Dorottya Marko, Hui Yu | 49 | -1 | . . . ggggggggggaatgcgagagaagagcgtaa |
| BBa_K3425019 | iGEM Type IIS standard CDS template | Other | Nria Garriga Alonso, Bjrn Ancker Persson, Tereza Hubčkov, Dorottya Marko, Hui Yu | 49 | -1 | . . . aaaaaaaaaagcttcgagagaagagcgtaa |
| BBa_K3425020 | iGEM Type IIS standard terminator template | Other | Nria Garriga Alonso, Bjrn Ancker Persson, Tereza Hubčkov, Dorottya Marko, Hui Yu | 49 | -1 | . . . aaaaaaaaaacgctcgagagaagagcgtaa |
Dummy parts
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K3425021 | iGEM Type IIS standard Level 1 Dummy (TU-DY) | Other | Nuria Garriga Alonso, Bjorn Ancker Persson, Tereza Hubackova, Dorottya Marko, Hui Yu | 12 | -1 | ggagaacacgct |
| BBa_K3425022 | iGEM Type IIS standard Level 2 Dummy (MTU-DY) | Other | Nuria Garriga Alonso, Bjorn Ancker Persson, Tereza Hubackova, Dorottya Marko, Hui Yu | 12 | -1 | aatgaacaggta |
| BBa_K3425023 | iGEM Type IIS pSB1K01-DY | Other | Nria Garriga Alonso | 16 | -1 | ggaggctcgtatcgct |
| BBa_K3425024 | iGEM Type IIS pSB1K02-DY | Other | Nria Garriga Alonso | 16 | -1 | ggaggatagtgccgct |
| BBa_K3425025 | iGEM Type IIS pSB1K03-DY | Other | Nria Garriga Alonso | 16 | -1 | ggagagccgctgcgct |
| BBa_K3425026 | iGEM Type IIS pSB1K04-DY | Other | Nria Garriga Alonso | 16 | -1 | ggaggtgatcaccgct |
| BBa_K3425027 | iGEM Type IIS pSB3C11-DY | Other | Nria Garriga Alonso | 16 | -1 | aatgaactacggggta |
| BBa_K3425028 | iGEM Type IIS pSB3C12-DY | Other | Nria Garriga Alonso | 16 | -1 | aatgagctgcgtggta |
| BBa_K3425029 | iGEM Type IIS pSB3C13-DY | Other | Nria Garriga Alonso | 16 | -1 | aatgagtgtagtggta |
| BBa_K3425030 | iGEM Type IIS pSB3C14-DY | Other | Nria Garriga Alonso | 16 | -1 | aatgcaccgatcggta |
RBS
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K3425031 | RBS for Type IIS iGEM Standard Assembly | RBS | Tereza Hubackova | 18 | -1 | tcacacaggaaagtacta |
| BBa_K3425032 | RBS for Type IIS iGEM Standard Assembly | RBS | Tereza Hubackova | 17 | -1 | aaagaggagaaatagta |
| BBa_K3425033 | RBS for Type IIS iGEM Standard Assembly | RBS | Tereza Hubackova | 20 | -1 | attaaagaggagaaatagta |