Collections/BioFAB

This collection is a user contributed collection, and is not under curation by iGEM HQ/Registry.


The BIOFAB project consisted of a study regarding the engineering of genetic elements that control transcription in E. Coli. The idea arises from the core principle of engineering “building a machine with parts,” which has been applied by the researchers responsible for the BIOFAB project, in synthetic biology [1] . The study describes the design, building and testing process of ~500 transcription and translation elements that are compatible with an “expression operating unit (EOU)” (fig1) [1]. Additionally, the BIOFAB project has recorded the strength/efficiency on translation and transcription of the aforementioned parts in different contexts. A reliable source that would provide information regarding the efficiency of transcription/translation elements would allow for one of the most common genetic engineering obstacles to be overcomed, which is “...the lack of standard parts that can be reused reliably in novel combinations...” [1]. This collection of parts provides information anyone can use in the mission to advance the knowledge of synthetic biology and genetic engineering.

BIOFAB Promoter Strengths

Fig 1. The graph shows the GFP expression relative to each promoter from the Modular promoter and randomized library.

Design

The Modular Promoter Library and the Randomized Promoter Library were “assembled on medium-copy vectors derived from pFAB21... and pFAB216. Both  pFAB217 and pFAB216 were derived from the same backbone vector pBbA2k-RFP54” (in other words the plasmids used to design the modular and randomized promoter libraries were both derived from a backbone vector “pBbA2k-RFP54”).  The medium-copy vectors were derived from the backbone vector by “replacing the Ptet promoter and the tetR gene with a defined sequence context including the Ptrc promoter and Bujard RBS (ribosomal sub-unit) region.” To design an expression operating unit (EOU) “an additional upstream region composed of three-frame stop codons, an intrinsic termi- nator56, a transcriptional pause site57 and an insulator region58 are introduced.” Design of the up and downstream terminators was needed to decrease the chance of interaction among the “EOU and the genetic context.” This way the functional parts can be separated from the EOU regions and the categorization of parts is more reliable.

        -The Modular Promoter Library was “engineered by a combination of three modules originating from five promoters with different strengths”(125 total).  The promoters were: “T7A1 promoter, Ptrc promoter, T5N25 promoter, the weaker NM535 series, and U56D46 version of the pRM promoter series.”

        -The Randomized Promoter Library  was created by randomizing the −10 motif (NTANNNTN) or the −35 motif (NTTNNNN) or both the −10 and −35 motifs of a strong Ptrc* constitutive promoter (TTGA CAATTAATCATCCGGCTCGTATAATGTGTGGA)...

BIOFAB Expression Operation Unit (EOU)

Fig 2: Wider icons represent the variable regions within each element type. The labeled lines between elements are detailed as well. This picture and explanation of the BIOFAB Expression Operating Unit are obtained from source [1].

Build

Modular Promoter Library: To build the MPL,

  1.   Make  “plasmid pFAB517 by amplifying the backbone vector pFAB217 (encoding the reporter GFP) using phosphorylated primers oFAB124 and oFAB125.”
  2. Purify the PCR-amplified vector backbone products “using Qiagen PCR purification kits, digested with DpnI, self-ligated using T4 DNA ligase enzyme and transformed into chemically competent BW25113 E. coli cells.”
  3. Then confirm the positive clones by sequencing (with soFAB1 and soFAB8 primers.
  4. Store clones  as glycerol stocks.
  5. Prepare “plasmid minipreps.... and use them for “further MPL construction purposes.”
  6. The BsaI enzyme will then digest the Minipreps of these backbone vectors (37 °C, overnight (> 16 h)), then dephosphorylate, and  gel-­purify (Qiagen), which are used for the promoter library.
  7. “To prepare the promoter elements as inserts for building the MPL...125 forward and 125 reverse oligonucleotides (short DNA/RNA molecules)” were designed  “such that they can be annealed together and their overhangs are compatible with the restriction-digested backbone vector pFAB517.”

Randomized Promoter Library:

  1. Amplify the −35, plasmid pFAB217 using phosphorylated primers oFAB176 and oFAB179. The forward primer oFAB176 retains the consensus −10 motif of the Ptrc promoter, and the reverserimer oFAB179 creates variants of the −35 motif (NTTNNNN).”
  2. “The phosphorylated primers oFAB178 and oFAB179 were used to randomize both the –10 motif and the –35 motif.”
  3. Purify the PCR products “using Qiagen PCR purification kit and digested with DpnI to remove the intact backbone vector.”
  4.  “PCR products were then ligated using T4 DNA ligase, transformed into chemically competent BW25113 E. coli cells and grown overnight in selective LB agar medium (with kan) on three large QTray plates.”
  5. “The next day, about 2,000 colonies were picked from all three transformation plates (in total) and grown overnight (~16 h, at 37 °C, 900 r.p.m. on an Inforys shaker) in 500 μl MOPS EZ Rich +kan medium in 96–deep-well plates sealed with a breathable membrane.”
  6. “The following day, 250 μl of overnight culture was stored as a pre-sequencing glycerol stock (250 μl overnight culture + 250 μl of 30% sterile glycerol), and the remaining 150 μl of the overnight culture was subjected to the microplate end-point assay to measure growth (optical density, OD600 nm) and fluorescence (relative fluorescence units or RFU) at an excitation of 481 nm and emission of 507 nm for GFP in a multimode microplate reader-incubator-shaker Synergy-2 (BioTek Instruments).”

Test

Note that the testing for the Randomized and Modular promoter libraries is the same. The testing was done in the experiment through the following process:

  1. Store Assay Strains as Glycerol stocks in 96-deep-well plates (2ml).
  2. Grow “cultures in 2–ml–, 96–deep-well plates containing 400 μl of MOPS EZ Rich Medium (Teknova, cat. #M2105) with appropriate antibiotics, inoculating 3 μl from thawed glycerol stocks. Cultures were grown overnight (approximately 16h) in plates of 96 U-Shaped 2ml wells covered with sterile breathable sealing film at 37 °C with shaking at 900 r.p.m. on a Multitron shaker (Infors-HT).”
  3. “Overnight cultures were diluted 1:50 into a final volume of 150 μl of fresh medium with appropriate antibiotics in clear-bottom black plates and incubated in a multimode  microplate reader-incubator-shaker Synergy-2 (BioTek Instruments).”
  4. The cultures were grown with rapid shaking for 6h and repeated  measurements for optical density and fluorescence (RFU).
  5. “481-nm excitation and 507-nm emission for GFP; 560-nm excitation and 650-nm emission for RFP) were performed every 10 min.”

*Note: “All microplate kinetic assay experi-ments were repeated at least three times starting from inde-pendent overnight cultures.”

  1. For data acquisition Gen5 software for BioTek plate readers was used. The data acquired was analyzed using MATLAB software.
  2. Flow cytometer assays: 1:50 dilution of overnight cultures into 200 μl fresh medium “in 1-ml deep-well plates and grown for 2 h (to expo-nential phase with OD600 in the range of 0.3–0.5 in the microplate reader) at 37 °C with shaking at 900 r.p.m. on the Multitron shaker.”
  3. To encode the T7 promoter “the overnight cultures of BL21 (DE3) with plasmid libraries were diluted 1:50 in to a final volume of 200 μl fresh MOPS EZ Rich Medium with appropriate antibiotics and 0.4 mM IPTG (to induce T7 RNAP expression from wild-type lac promoter on chromosome) in 1-ml-deep–well plates and grown for 2 h (to exponential phase with OD600 in the range of 0.3–0.5 in the microplate reader) at 37 °C with shaking at 900 r.p.m. on a Multitron shaker.”
  4. “Cultures were diluted 1:2,000 in chilled and filtered PBS (pH 7.4) containing 500 μg/ml streptomycin in chilled 96-well clear plates (Costar) and immediately subjected to flow cytometer analysis.”
  5. “...A Guava easyCyte flow cytometer (EMD Millipore), equipped with microcapillary and autosampling capabilities, and paired dual blue (488-nm, 75-mW) and green (532-nm,40-mW) laser excitation with two customized filter options for emission detection of 510/20 for GFP and 610/20 for RFP,respectively” was used for the aforementioned analysis.
  6. “During the assay, the sample concentration was kept below 500 cells per μl, and samples were run on a high flow rate (1.18 μl/s) until 2,000 cells (with a range of 60–300 events per μl) had been collected within small forward- and side-scatter gates scripts15.”
  7. To calculate the fluorescence-per-cell values for the GOI, log-2 transformation followed by a mean-normalization was utilized in the experiment to analyze and compare fluorescence from “sequence-dis
  8.  The fluorescence-per-cell values for each GOI construct were log2-transformed and then mean-normalized for comparative analysis of fluorescence from sequence-distinct GOI fusions.”

An average “score” for part activity was calculated by “systematically assembling and testing all combinations of frequently used prokaryotic transcription and translation control elements,” additionally the activity variations of parts in new combinations was quantified [1].

Reference

Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). https://doi.org/10.1038/nmeth.2404

Modular Promoter Library

     </tr>
iGEM Registry Name BIOFAB ID Strength (mean fluorescence per cell)
BBa_M36303 apFAB46 897.636
BBa_K2832101 apFAB70 866.671
BBa_K2832106 apFAB71 866.296
BBa_K2832103 apFAB61 857.927
BBa_K2832104 apFAB80 787.199
BBa_K2832105 apFAB45 785.309
BBa_K2832106 apFAB47 782.004
BBa_K2832107 apFAB31 781.826
BBa_K2832108 apFAB55 768.983
BBa_K2832109 apFAB68 766.301
BBa_K2832110 apFAB101 757.959
BBa_K2832111 apFAB96 748.822
BBa_K2832112 apFAB56 743.476
BBa_K2832113 apFAB81 742.631
BBa_K2832114 apFAB92 742.334
BBa_K2832115 apFAB72 737.59
BBa_K2832116 apFAB100 736.966
BBa_K2832117 apFAB76 736.51
BBa_K2832118 apFAB30 731.463
BBa_K2832119 apFAB79 728.654
BBa_K2832120 apFAB75 717.72
BBa_K2832121 apFAB50 707.166
BBa_K2832122 apFAB93 706.957
BBa_K2832123 apFAB60 700.31
BBa_K2832124 apFAB54 690.839
BBa_K2832125 apFAB62 687.948
BBa_K2832126 apFAB42 685.34
BBa_K2832127 apFAB53 682.888
BBa_K2832128 apFAB85 674.421
BBa_K2832129 apFAB65 670.065
BBa_K2832130 apFAB52 666.998
BBa_K2832131 apFAB67 649.993
BBa_K2832132 apFAB32 645.519
BBa_K2832133 apFAB57 637.488
BBa_K2832134 apFAB39 594.378
BBa_K2832135 apFAB115 573.792
BBa_K2832136 apFAB29 565.946
BBa_K2832137 apFAB77 555.565
BBa_K2832138 apFAB36 547.956
BBa_K2832139 apFAB44 540.856
BBa_K2832140 apFAB102 534.826
BBa_K2832141 apFAB37 530.604
BBa_K2832142 apFAB41 523.35
BBa_K2832143 apFAB63 518.502
BBa_K2832144 apFAB140 508.942
BBa_K2832145 apFAB64 508.117
BBa_K2832146 apFAB40 488.364
BBa_K2832147 apFAB97 477.744
BBa_K2832148 apFAB78 476.327
BBa_K2832149 apFAB69 474.513
BBa_K2832150 apFAB103 459.253
BBa_K2832151 apFAB73 456.758
BBa_K2832152 apFAB66 439.276
BBa_K2832153 apFAB126 433.829
BBa_K2832154 apFAB95 425.407
BBa_K2832155 apFAB151 422.838
BBa_K2832156 apFAB48 411.861
BBa_K2832157 apFAB82 389.529
BBa_K2832158 apFAB141 376.932
BBa_K2832159 apFAB150 366.498
BBa_K2832160 apFAB125 363.199
BBa_K2832161 apFAB33 340.476
BBa_K2832162 apFAB121 328.946
BBa_K2832163 apFAB111 327.288
BBa_K2832164 apFAB58 287.687
BBa_K2832165 apFAB94 279.605
BBa_K2832166 apFAB145 271.14
BBa_K2832167 apFAB118 267.819
BBa_K2832168 apFAB106 256.824
BBa_K2832169 apFAB110 254.676
BBa_K2832170 apFAB105 243.758
BBa_K2832171 apFAB38 239.875
BBa_K2832172 apFAB89 223.766
BBa_K2832173 apFAB142 214.923
BBa_K2832174 apFAB130 182.202
BBa_K2832175 apFAB131 167.803
BBa_K2832176 apFAB143 157.015
BBa_K2832177 apFAB87 145.215
BBa_K2832178 apFAB104 126.832
BBa_K2832179 apFAB98 120.521
BBa_K2832180 apFAB51 103.187
BBa_K2832181 apFAB49 93.9231
BBa_K2832182 apFAB120 81.7515
BBa_K2832183 apFAB83 79.3039
BBa_K2832184 apFAB117 62.9585
BBa_K2832185 apFAB129 60.7537
BBa_K2832186 apFAB146 58.9582
BBa_K2832187 apFAB59 58.498
BBa_K2832188 apFAB127 48.3838
BBa_K2832189 apFAB88 48.354
BBa_K2832190 apFAB86 44.6204
BBa_K2832191 apFAB74 44.6094
BBa_K2832192 apFAB152 40.7219
BBa_K2832193 apFAB122 36.8209
BBa_K2832194 apFAB128 26.6541
BBa_K2832195 apFAB99 26.5471
BBa_K2832196 apFAB119 20.866
BBa_K2832197 apFAB112 17.3114
BBa_K2832198 apFAB34 14.6339
BBa_K2832199 apFAB147 13.3236
BBa_K2832200 apFAB144 13.0792
BBa_K2832201 apFAB35 12.6234
BBa_K2832202 apFAB107 11.4242
BBa_K2832203 apFAB123 11.2076
BBa_K2832204 apFAB137 7.09512
BBa_K2832205 apFAB113 5.32229
BBa_K2832206 apFAB84 4.73181
BBa_K2832207 apFAB148 4.01421
BBa_K2832208 apFAB108 3.64128
BBa_K2832209 apFAB114 3.35398
BBa_K2832210 apFAB136 3.19915
BBa_K2832211 apFAB124 2.64681
BBa_K2832212 apFAB149 2.52982
BBa_K2832213 apFAB134 2.52663
BBa_K2832214 apFAB138 1.64153
BBa_K2832215 apFAB43 1.0947
BBa_K2832216 apFAB133 0.84608
BBa_K2832217 apFAB139 0.681873
BBa_K2832218 apFAB91 0.42395
BBa_K2832219 apFAB90 0.378777

Randomized Promoter Library

Parts Registry Name BIOFAB ID Strength (mean fluorescence per cell)
BBa_J97008 apFAB342 740.35
BBa_K3702000 apFAB347 738.40
BBa_K3702001 apFAB345 714.53
BBa_K3702002 apFAB341 668.45
BBa_K3702003 apFAB317 654.56
BBa_K3702004 apFAB338 615.44
BBa_K3702005 apFAB323 611.20
BBa_K3702006 apFAB339 580.23
BBa_K3702007 apFAB321 557.04
BBa_K3702008 apFAB340 538.51
BBa_K3702009 apFAB322 516.83
BBa_K3702010 apFAB346 466.88
BBa_K3702011 apFAB303 345.31
BBa_K3702012 apFAB302 342.55
BBa_K3702013 apFAB297 339.75
BBa_K3702014 apFAB301 338.31
BBa_K3702015 apFAB298 327.52
BBa_K3702016 apFAB306 307.03
BBa_K3702017 apFAB307 283.99
BBa_K3702018 apFAB296 277.56
BBa_K3702019 apFAB308 269.83
BBa_K3702020 apFAB295 252.47
BBa_K3702021 apFAB300 246.62
BBa_K3702022 apFAB299 203.95
BBa_K3702023 apFAB309 199.95
BBa_K3702024 apFAB305 164.05
BBa_K3702025 apFAB313 160.29
BBa_K3702026 apFAB310 156.73
BBa_K3702027 apFAB311 155.52
BBa_K3702028 apFAB279 145.82
BBa_K3702029 apFAB314 141.99
BBa_K3702030 apFAB281 139.88
BBa_K3702031 apFAB276 138.28
BBa_K3702032 apFAB312 135.53
BBa_K3702033 apFAB273 128.84
BBa_K3702034 apFAB316 123.38
BBa_K3702035 apFAB282 105.12
BBa_K3702036 apFAB260 99.29
BBa_K3702037 apFAB293 98.98
BBa_K3702038 apFAB259 95.97
BBa_K3702039 apFAB284 77.82
BBa_K3702040 apFAB285 76.92
BBa_K3702041 apFAB286 76.12
BBa_K3702042 apFAB257 75.39
BBa_K3702043 apFAB267 74.39
BBa_K3702044 apFAB263 70.05
BBa_K3702045 apFAB262 65.83
BBa_K3702046 apFAB265 63.55
BBa_K3702047 apFAB271 59.33
BBa_K3702048 apFAB278 58.41
BBa_K3702049 apFAB241 57.40
BBa_K3702050 apFAB280 57.40
BBa_K3702051 apFAB254 57.29
BBa_K3702052 apFAB266 56.78
BBa_K3702053 apFAB270 55.67
BBa_K3702054 apFAB287 52.53
BBa_K3702055 apFAB256 49.71
BBa_K3702056 apFAB253 49.10
BBa_K3702057 apFAB264 48.80
BBa_K3702058 apFAB337 48.57
BBa_K3702059 apFAB261 47.13
BBa_K3702060 apFAB272 45.89
BBa_K3702061 apFAB274 44.90
BBa_K3702062 apFAB258 39.55
BBa_K3702063 apFAB255 38.32
BBa_K3702064 apFAB268 38.05
BBa_K3702065 apFAB333 34.24
BBa_K3702066 apFAB326 33.51
BBa_K3702067 apFAB343 33.50
BBa_K3702068 apFAB329 33.21
BBa_K3702069 apFAB332 32.73
BBa_K3702070 apFAB252 32.49
BBa_K3702071 apFAB251 30.07
BBa_K3702072 apFAB226 29.25
BBa_K3702073 apFAB315 25.64
BBa_K3702074 apFAB335 21.55
BBa_K3702075 apFAB334 21.08
BBa_K3702076 apFAB319 20.39
BBa_K3702077 apFAB229 15.31
BBa_K3702078 apFAB228 14.36
BBa_K3702079 apFAB225 13.71
BBa_K3702080 apFAB224 13.10
BBa_K3702081 apFAB324 12.77
BBa_K3702082 apFAB230 12.69
BBa_K3702083 apFAB318 12.62
BBa_K3702084 apFAB331 11.14
BBa_K3702085 apFAB304 10.75
BBa_K3702086 apFAB231 10.58
BBa_K3702087 apFAB227 9.46
BBa_K3702088 apFAB209 8.05
BBa_K3702089 apFAB202 5.83
BBa_K3702090 apFAB212 5.57
BBa_K3702091 apFAB211 5.30
BBa_K3702092 apFAB221 4.87
BBa_K3702093 apFAB205 4.80
BBa_K3702094 apFAB201 4.75
BBa_K3702095 apFAB193 4.48
BBa_K3702096 apFAB203 4.46
BBa_K3702097 apFAB200 4.41
BBa_K37020998 apFAB207 4.26
BBa_K3702099 apFAB206 4.20
BBa_K3702100 apFAB194 4.17
BBa_K3702101 apFAB208 4.17
BBa_K3702102 apFAB181 4.00
BBa_K3702103 apFAB204 3.85
BBa_K3702104 apFAB190 3.75
BBa_K3702105 apFAB189 3.69
BBa_K3702106 apFAB184 3.62
BBa_K3702107 apFAB215 3.44
BBa_K3702108 apFAB168 3.33
BBa_K3702109 apFAB197 3.28
BBa_K3702110 apFAB199 3.27
BBa_K3702111 apFAB216 3.09
BBa_K3702112 apFAB180 2.98
BBa_K3702113 apFAB187 2.97
BBa_K3702114 apFAB182 2.94
BBa_K3702115 apFAB186 2.92
BBa_K3702116 apFAB183 2.76
BBa_K3702117 apFAB195 2.73
BBa_K3702118 apFAB167 2.68
BBa_K3702119 apFAB177 2.67
BBa_K3702120 apFAB192 2.57
BBa_K3702121 apFAB220 2.55
BBa_K3702122 apFAB161 2.54
BBa_K3702123 apFAB160 2.52
BBa_K3702124 apFAB162 2.51
BBa_K3702125 apFAB159 2.50
BBa_K3702126 apFAB164 2.50
BBa_K3702127 apFAB166 2.49
BBa_K3702128 apFAB157 2.48
BBa_K3702129 apFAB217 2.48
BBa_K3702130 apFAB156 2.46
BBa_K3702131 apFAB213 2.33
BBa_K3702132 apFAB325 2.24
BBa_K3702133 apFAB188 1.93
BBa_K3702134 apFAB210 1.80
BBa_K3702135 apFAB327 0.75
BBa_K3702136 apFAB294 0.21

Terminator Library

iGEM Registry Name BIOFAB ID Termination Efficiency
BBa_K3702137 apFAB352
BBa_K3702138 apFAB353
BBa_K3702139 apFAB354
BBa_K3702140 apFAB355
BBa_K3702141 apFAB356
BBa_K3702142 apFAB357
BBa_K3702143 apFAB358
BBa_K3702144 apFAB359
BBa_K3702145 apFAB360
BBa_K3702146 apFAB361
BBa_K3702147 apFAB362
BBa_K3702148 apFAB363
BBa_K3702149 apFAB364
BBa_K3702150 apFAB365
BBa_K3702151 apFAB366
BBa_K3702152 apFAB367
BBa_K3702153 apFAB368
BBa_K3702154 apFAB369
BBa_K3702155 apFAB370
BBa_K3702156 apFAB371
BBa_K3702157 apFAB372
BBa_K3702158 apFAB373
BBa_K3702159 apFAB374
BBa_K3702160 apFAB375
BBa_K3702161 apFAB376
BBa_K3702162 apFAB377
BBa_K3702163 apFAB378
BBa_K3702164 apFAB379
BBa_K3702165 apFAB380
BBa_K3702166 apFAB381
BBa_K3702167 apFAB382
BBa_K3702168 apFAB383
BBa_K3702169 apFAB384
BBa_K3702170 apFAB385
BBa_K3702171 apFAB386
BBa_K3702172 apFAB387
BBa_K3702173 apFAB388
BBa_K3702174 apFAB389
BBa_K3702175 apFAB390
BBa_K3702176 apFAB391

Modular Promoters Table Generated by the Registry


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K2832181BIOFAB Modular Promoter apFAB4947BIOFAB1276 RegulatoryNot in stock
BBa_K2832159BIOFAB Modular Promoter apFAB15045BIOFAB1277 RegulatoryNot in stock
BBa_K2832108BIOFAB modular Promoter apFAB5538BIOFAB1276 RegulatoryNot in stock
BBa_K2832106BIOFAB Modular Promoter apFAB4747BIOFAB1277 RegulatoryNot in stock
BBa_K2832201BIOFAB Modular Promoter apFAB3547BIOFAB1277 RegulatoryNot in stock
BBa_K2832204BIOFAB Modular Promoter apFAB13745BIOFAB1276 RegulatoryNot in stock
BBa_K2832179BIOFAB Modular Promoter apFAB9848BIOFAB1277 RegulatoryNot in stock
BBa_K2832144BIOFAB Modular Promoter apFAB14045BIOFAB1280 RegulatoryNot in stock
BBa_K2832134BIOFAB Modular Promoter apFAB3947BIOFAB1276 RegulatoryNot in stock
BBa_K2832169BIOFAB Modular Promoter apFAB11037BIOFAB1278 RegulatoryNot in stock
BBa_K2832163BIOFAB modular Promoter apFAB11137BIOFAB1278 RegulatoryNot in stock
BBa_K2832192BIOFAB Modular Promoter apFAB15245BIOFAB1277 RegulatoryNot in stock
BBa_K2832115BIOFAB Modular Promoter apFAB7237BIOFAB1277 RegulatoryNot in stock
BBa_K2832101BIOFAB Modular Promoter apFAB7037BIOFAB1276 RegulatoryNot in stock
BBa_K2832113BIOFAB Modular Promoter apFAB8149BIOFAB1277 RegulatoryNot in stock
BBa_K2832182BIOFAB Modular Promoter apFAB12037BIOFAB1277 RegulatoryNot in stock
BBa_K2832147BIOFAB Modular Promoter apFAB9748BIOFAB1280 RegulatoryNot in stock
BBa_K2832104BIOFAB Modular Promoter apFAB8049BIOFAB1277 RegulatoryNot in stock
BBa_K2832191BIOFAB Modular Promoter apFAB7437BIOFAB1278 RegulatoryNot in stock
BBa_K2832150BIOFAB Modular Promoter apFAB10348BIOFAB1277 RegulatoryNot in stock
BBa_K2832107BIOFAB modular Promoter apFAB3148BIOFAB1276 RegulatoryNot in stock
BBa_K2832141BIOFAB Modular Promoter apFAB3747BIOFAB1277 RegulatoryNot in stock
BBa_K2832145bIOFAB Modular Promoter apFAB6437BIOFAB1279 RegulatoryNot in stock
BBa_K2832100BIOFAB Modular Promoter apFAB4647BIOFAB12881RegulatoryNot in stock
BBa_K2832216BIOFAB Modular Promoter apFAB13346BIOFAB1277 RegulatoryNot in stock
BBa_K2832126BIOFAB Modular Promoter apFAB4247BIOFAB1276 RegulatoryNot in stock
BBa_K2832125BIOFAB Modular Promoter apFAB6237BIOFAB1279 RegulatoryNot in stock
BBa_K2832128BIOFAB Modular Promoter apFAB8548BIOFAB1276 RegulatoryNot in stock
BBa_K2832119BIOFAB Modular Promoter apFAB7949BIOFAB1277 RegulatoryNot in stock
BBa_K2832156BIOFAB Modular Promoter apFAB4847BIOFAB1277 RegulatoryNot in stock
BBa_K2832124BIOFAB Modular Promoter apFAB5438BIOFAB1278 RegulatoryNot in stock
BBa_K2832178BIOFAB Modular Promoter apFAB10438BIOFAB1277 RegulatoryNot in stock
BBa_K2832160BIOFAB Modular Promoter apFAB12537BIOFAB1278 RegulatoryNot in stock
BBa_K2832109BIOFAB modular Promoter apFAB6837BIOFAB1276 RegulatoryNot in stock
BBa_K2832210BIOFAB Modular Promoter apFAB13645BIOFAB1276 RegulatoryNot in stock
BBa_K2832158BIOFAB Modular Promoter apFAB14145BIOFAB1277 RegulatoryNot in stock
BBa_K2832118BIOFAB Modular Promoter apFAB3048BIOFAB1278 RegulatoryNot in stock
BBa_K2832215BIOFAB Modular Promoter apFAB4347BIOFAB1277 RegulatoryNot in stock
BBa_K2832129BIOFAB Modular Promoter apFAB6537BIOFAB1277 RegulatoryNot in stock
BBa_K2832132BIOFAB Modular Promoter apFAB3248BIOFAB1277 RegulatoryNot in stock
BBa_K2832189BIOFAB Modular Promoter apFAB8848BIOFAB1278 RegulatoryNot in stock
BBa_K2832168BIOFAB Modular Promoter apFAB10638BIOFAB1278 RegulatoryNot in stock
BBa_K2832117BIOFAB Modular Promoter apFAB7637BIOFAB1277 RegulatoryNot in stock
BBa_K2832102BIOFAB Modular Promoter apFAB7137BIOFAB1276 RegulatoryNot in stock
BBa_K2832103BIOFAB Modular Promoter apFAB6137BIOFAB1276 RegulatoryNot in stock
BBa_K2832105BIOFAB Modular Promoter apFAB4547BIOFAB1277 RegulatoryNot in stock
BBa_K2832110BIOFAB modular Promoter apFAB10148BIOFAB1276 RegulatoryNot in stock
BBa_K2832111BIOFAB Modular Promoter apFAB9648BIOFAB1276 RegulatoryNot in stock
BBa_K2832112BIOFAB Modular Promoter apFAB5638BIOFAB1276 RegulatoryNot in stock
BBa_K2832114BIOFAB Modular Promoter apFAB9248BIOFAB1277 RegulatoryNot in stock
BBa_K2832116BIOFAB Modular Promoter apFAB10048BIOFAB1278 RegulatoryNot in stock
BBa_K2832120BIOFAB Modular Promoter apFAB7537BIOFAB1276 RegulatoryNot in stock
BBa_K2832121BIOFAB Modular Promoter apFAB5047BIOFAB1276 RegulatoryNot in stock
BBa_K2832122BIOFAB Modular Promoter apFAB9348BIOFAB1275 RegulatoryNot in stock
BBa_K2832123BIOFAB Modular Promoter apFAB6037BIOFAB1276 RegulatoryNot in stock
BBa_K2832137BIOFAB Modular Promoter apFAB7737BIOFAB1279 RegulatoryNot in stock
BBa_K2832127BIOFAB Modular Promoter apFAB5347BIOFAB1278 RegulatoryNot in stock
BBa_K2832130BIOFAB Modular Promoter apFAB5247BIOFAB1279 RegulatoryNot in stock
BBa_K2832131BIOFAB Modular Promoter apFAB6737BIOFAB1277 RegulatoryNot in stock
BBa_K2832133BIOFAB Modular Promoter apFAB5738BIOFAB1276 RegulatoryNot in stock
BBa_K2832135BIOFAB Modular Promoter apFAB11537BIOFAB1276 RegulatoryNot in stock
BBa_K2832136BIOFAB Modular Promoter apFAB2948BIOFAB1277 RegulatoryNot in stock
BBa_K2832138BIOFAB Modular Promoter apFAB3647BIOFAB1276 RegulatoryNot in stock
BBa_K2832139BIOFAB Modular Promoter apFAB4447BIOFAB1279 RegulatoryNot in stock
BBa_K2832140BIOFAB Modular Promoter apFAB10248BIOFAB1277 RegulatoryNot in stock
BBa_K2832142BIOFAB Modular Promoter apFAB4147BIOFAB1276 RegulatoryNot in stock
BBa_K2832143BIOFAB Modular Promoter apFAB6337BIOFAB1280 RegulatoryNot in stock
BBa_K2832217BIOFAB Modular Promoter apFAB13945BIOFAB1277 RegulatoryNot in stock
BBa_K2832203BIOFAB modular Promoter apFAB12337BIOFAB1277 RegulatoryNot in stock
BBa_K2832172BIOFAB Modular Promoter apFAB8948BIOFAB1278 RegulatoryNot in stock
BBa_K2832146BIOFAB Modular Promoter apFAB4047BIOFAB1280 RegulatoryNot in stock
BBa_K2832148BIOFAB modular Promoter apFAB7837BIOFAB1278 RegulatoryNot in stock
BBa_K2832149BIOFAB Modular Promoter apFAB6937BIOFAB1277 RegulatoryNot in stock
BBa_K2832151BIOFAB Modular Promoter apFAB7337BIOFAB1280 RegulatoryNot in stock
BBa_K2832152BIOFAB Modular Promoter apFAB6637BIOFAB1278 RegulatoryNot in stock
BBa_K2832153BIOFAB Modular Promoter apFAB12637BIOFAB1277 RegulatoryNot in stock
BBa_K2832154BIOFAB Modular Promoter apFAB9548BIOFAB1277 RegulatoryNot in stock
BBa_K2832155BIOFAB Modular Promoter apFAB15145BIOFAB1278 RegulatoryNot in stock
BBa_K2832157BIOFAB Modular Promoter apFAB8249BIOFAB12771RegulatoryNot in stock
BBa_K2832161BIOFAB Modular Promoter apFAB3348BIOFAB1278 RegulatoryNot in stock
BBa_K2832162BIOFAB Modular Promoter apFAB12137BIOFAB1278 RegulatoryNot in stock
BBa_K2832164BIOFAB modular Promoter apFAB5838BIOFAB1277 RegulatoryNot in stock
BBa_K2832165BIOFAB modular Promoter apFAB9448BIOFAB1278 RegulatoryNot in stock
BBa_K2832166BIOFAB modular Promoter apFAB14545BIOFAB1278 RegulatoryNot in stock
BBa_K2832167BIOFAB Modular Promoter apFAB11837BIOFAB1278 RegulatoryNot in stock
BBa_K2832214BIOFAB Modular Promoter apFAB13845BIOFAB1277 RegulatoryNot in stock
BBa_K2832170BIOFAB Modular Promoter apFAB10538BIOFAB1278 RegulatoryNot in stock
BBa_K2832171BIOFAB Modular Promoter apFAB3847BIOFAB1276 RegulatoryNot in stock
BBa_K2832173BIOFAB Modular Promoter apFAB14245BIOFAB1278 RegulatoryNot in stock
BBa_K2832174BIOFAB Modular Promoter apFAB13046BIOFAB1277 RegulatoryNot in stock
BBa_K2832175BIOFAB Modular Promoter apFAB13146BIOFAB1278 RegulatoryNot in stock
BBa_K2832176BIOFAB Modular Promoter apFAB14345BIOFAB1277 RegulatoryNot in stock
BBa_K2832177BIOFAB Modular Promoter apFAB8748BIOFAB1279 RegulatoryNot in stock
BBa_K2832180BIOFAB Modular Promoter apFAB5147BIOFAB1277 RegulatoryNot in stock
BBa_K2832183BIOFAB Modular Promoter apFAB8349BIOFAB1277 RegulatoryNot in stock
BBa_K2832184BIOFAB Modular Promoter apFAB11737BIOFAB1276 RegulatoryNot in stock
BBa_K2832185BIOFAB Modular Promoter apFAB12946BIOFAB1277 RegulatoryNot in stock
BBa_K2832186BIOFAB Modular Promoter apFAB14645BIOFAB1277 RegulatoryNot in stock
BBa_K2832187BIOFAB Modular Promoter apFAB5937BIOFAB1277 RegulatoryNot in stock
BBa_K2832188BIOFAB Modular Promoter apFAB12737BIOFAB1277 RegulatoryNot in stock
BBa_K2832190BIOFAB Modular Promoter apFAB8648BIOFAB1277 RegulatoryNot in stock
BBa_K2832193BIOFAB Modular Promoter apFAB12237BIOFAB1277 RegulatoryNot in stock
BBa_K2832194BIOFAB Modular Promoter apFAB12837BIOFAB1278 RegulatoryNot in stock
BBa_K2832195BIOFAB Modular Promoter apFAB9948BIOFAB1276 RegulatoryNot in stock
BBa_K2832196BIOFAB Modular Promoter apFAB11937BIOFAB1277 RegulatoryNot in stock
BBa_K2832197BIOFAB Modular Promoter apFAB11237BIOFAB1277 RegulatoryNot in stock
BBa_K2832198BIOFAB Modular Promoter apFAB3447BIOFAB1277 RegulatoryNot in stock
BBa_K2832199BIOFAB Modular Promoter apFAB14745BIOFAB1277 RegulatoryNot in stock
BBa_K2832200BIOFAB Modular Promoter apFAB14445BIOFAB1278 RegulatoryNot in stock
BBa_K2832202BIOFAB modular Promoter apFAB10738BIOFAB1277 RegulatoryNot in stock
BBa_K2832205BIOFAB Modular Promoter apFAB11337BIOFAB1277 RegulatoryNot in stock
BBa_K2832206BIOFAB Modular Promoter apFAB8448BIOFAB1277 RegulatoryNot in stock
BBa_K2832207BIOFAB Modular Promoter apFAB14845BIOFAB1277 RegulatoryNot in stock
BBa_K2832208BIOFAB Modular Promoter apFAB10838BIOFAB1277 RegulatoryNot in stock
BBa_K2832209BIOFAB Modular Promoter apFAB11437BIOFAB1276 RegulatoryNot in stock
BBa_K2832211BIOFAB Modular Promoter apFAB12437BIOFAB1277 RegulatoryNot in stock
BBa_K2832212BIOFAB Modular Promoter apFAB14945BIOFAB1277 RegulatoryNot in stock
BBa_K2832213BIOFAB Modular Promoter apFAB13445BIOFAB1278 RegulatoryNot in stock
BBa_K2832218BIOFAB Modular Promoter apFAB9148BIOFAB1277 RegulatoryNot in stock
BBa_K2832219BIOFAB Modular Promoter apFAB9048BIOFAB12771RegulatoryNot in stock

Randomized Promoters Table Generated by the Registry


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K3702038BIOFAB Random Promoter apFAB25936BIOFAB -1Regulatory 
BBa_K3702064BIOFAB Random Promoter apFAB26836BIOFAB -1Regulatory 
BBa_K3702054BIOFAB Random Promoter apFAB28736BIOFAB -1Regulatory 
BBa_K3702037BIOFAB Random Promoter apFAB29336BIOFAB -1Regulatory 
BBa_J97008BIOFAB Random Promoter apFAB34236BIOFAB -1Regulatory 
BBa_K3702000BIOFAB Random Promoter apFAB34736BIOFAB -1Regulatory 
BBa_K3702001BIOFAB Random Promoter apFAB34536BIOFAB -1Regulatory 
BBa_K3702002BIOFAB Random Promoter apFAB34136BIOFAB -1Regulatory 
BBa_K3702003BIOFAB Random Promoter apFAB31736BIOFAB -1Regulatory 
BBa_K3702004BIOFAB Random Promoter apFAB33836BIOFAB -1Regulatory 
BBa_K3702005BIOFAB Random Promoter apFAB32336BIOFAB -1Regulatory 
BBa_K3702006BIOFAB Random Promoter apFAB33936BIOFAB -1Regulatory 
BBa_K3702007BIOFAB Random Promoter apFAB32136BIOFAB -1Regulatory 
BBa_K3702008BIOFAB Random Promoter apFAB34036BIOFAB -1Regulatory 
BBa_K3702009BIOFAB Random Promoter apFAB32236BIOFAB -1Regulatory 
BBa_K3702010BIOFAB Random Promoter apFAB34636BIOFAB -1Regulatory 
BBa_K3702011BIOFAB Random Promoter apFAB30335BIOFAB -1Regulatory 
BBa_K3702012BIOFAB Random Promoter apFAB30236BIOFAB -1Regulatory 
BBa_K3702013BIOFAB Random Promoter apFAB29736BIOFAB -1Regulatory 
BBa_K3702014BIOFAB Random Promoter apFAB30136BIOFAB -1Regulatory 
BBa_K3702015BIOFAB Random Promoter apFAB29836BIOFAB -1Regulatory 
BBa_K3702016BIOFAB Random Promoter apFAB30636BIOFAB -1Regulatory 
BBa_K3702017BIOFAB Random Promoter apFAB30736BIOFAB -1Regulatory 
BBa_K3702018BIOFAB Random Promoter apFAB29636BIOFAB -1Regulatory 
BBa_K3702019BIOFAB Random Promoter apFAB30836BIOFAB -1Regulatory 
BBa_K3702020BIOFAB Random Promoter apFAB29535BIOFAB -1Regulatory 
BBa_K3702021BIOFAB Random Promoter apFAB30036BIOFAB -1Regulatory 
BBa_K3702022BIOFAB Random Promoter apFAB29936BIOFAB -1Regulatory 
BBa_K3702023BIOFAB Random Promoter apFAB30936BIOFAB -1Regulatory 
BBa_K3702024BIOFAB Random Promoter apFAB30536BIOFAB -1Regulatory 
BBa_K3702025BIOFAB Random Promoter apFAB31336BIOFAB -1Regulatory 
BBa_K3702026BIOFAB Random Promoter apFAB31036BIOFAB -1Regulatory 
BBa_K3702027BIOFAB Random Promoter apFAB31136BIOFAB -1Regulatory 
BBa_K3702028BIOFAB Random Promoter apFAB27935BIOFAB -1Regulatory 
BBa_K3702029BIOFAB Random Promoter apFAB31436BIOFAB -1Regulatory 
BBa_K3702030BIOFAB Random Promoter apFAB28136BIOFAB -1Regulatory 
BBa_K3702031BIOFAB Random Promoter apFAB27635BIOFAB -1Regulatory 
BBa_K3702032BIOFAB Random Promoter apFAB31236BIOFAB -1Regulatory 
BBa_K3702033BIOFAB Random Promoter apFAB27336BIOFAB -1Regulatory 
BBa_K3702034BIOFAB Random Promoter apFAB31636BIOFAB -1Regulatory 
BBa_K3702035BIOFAB Random Promoter apFAB28236BIOFAB -1Regulatory 
BBa_K3702036BIOFAB Random Promoter apFAB26035BIOFAB -1Regulatory 
BBa_K3702039BIOFAB Random Promoter apFAB28436BIOFAB -1Regulatory 
BBa_K3702040BIOFAB Random Promoter apFAB28536BIOFAB -1Regulatory 
BBa_K3702041BIOFAB Random Promoter apFAB28636BIOFAB -1Regulatory 
BBa_K3702042BIOFAB Random Promoter apFAB25736BIOFAB -1Regulatory 
BBa_K3702043BIOFAB Random Promoter apFAB26736BIOFAB -1Regulatory 
BBa_K3702044BIOFAB Random Promoter apFAB26336BIOFAB -1Regulatory 
BBa_K3702045BIOFAB Random Promoter apFAB26236BIOFAB -1Regulatory 
BBa_K3702046BIOFAB Random Promoter apFAB26535BIOFAB -1Regulatory 
BBa_K3702047BIOFAB Random Promoter apFAB27136BIOFAB -1Regulatory 
BBa_K3702048BIOFAB Random Promoter apFAB27836BIOFAB -1Regulatory 
BBa_K3702049BIOFAB Random Promoter apFAB24135BIOFAB -1Regulatory 
BBa_K3702050BIOFAB Random Promoter apFAB28036BIOFAB -1Regulatory 
BBa_K3702051BIOFAB Random Promoter apFAB25436BIOFAB -1Regulatory 
BBa_K3702052BIOFAB Random Promoter apFAB26635BIOFAB -1Regulatory 
BBa_K3702053BIOFAB Random Promoter apFAB27035BIOFAB -1Regulatory 
BBa_K3702055BIOFAB Random Promoter apFAB25636BIOFAB -1Regulatory 
BBa_K3702056BIOFAB Random Promoter apFAB25336BIOFAB -1Regulatory 
BBa_K3702057BIOFAB Random Promoter apFAB26435BIOFAB -1Regulatory 
BBa_K3702058BIOFAB Random Promoter apFAB33736BIOFAB -1Regulatory 
BBa_K3702059BIOFAB Random Promoter apFAB26136BIOFAB -1Regulatory 
BBa_K3702060BIOFAB Random Promoter apFAB27235BIOFAB -1Regulatory 
BBa_K3702061BIOFAB Random Promoter apFAB27436BIOFAB -1Regulatory 
BBa_K3702062BIOFAB Random Promoter apFAB25836BIOFAB -1Regulatory 
BBa_K3702063BIOFAB Random Promoter apFAB25535BIOFAB -1Regulatory 
BBa_K3702065BIOFAB Random Promoter apFAB33336BIOFAB -1Regulatory 
BBa_K3702066BIOFAB Random Promoter apFAB32636BIOFAB -1Regulatory 
BBa_K3702067BIOFAB Random Promoter apFAB34336BIOFAB -1Regulatory 
BBa_K3702068BIOFAB Random Promoter apFAB32936BIOFAB -1Regulatory 
BBa_K3702069BIOFAB Random Promoter apFAB33236BIOFAB -1Regulatory 
BBa_K3702070BIOFAB Random Promoter apFAB25236BIOFAB -1Regulatory 
BBa_K3702071BIOFAB Random Promoter apFAB25136BIOFAB -1Regulatory 
BBa_K3702072BIOFAB Random Promoter apFAB22636BIOFAB -1Regulatory 
BBa_K3702073BIOFAB Random Promoter apFAB31536BIOFAB -1Regulatory 
BBa_K3702074BIOFAB Random Promoter apFAB33536BIOFAB -1Regulatory 
BBa_K3702075BIOFAB Random Promoter apFAB33436BIOFAB -1Regulatory 
BBa_K3702076BIOFAB Random Promoter apFAB31936BIOFAB -1Regulatory 
BBa_K3702077BIOFAB Random Promoter apFAB22936BIOFAB -1Regulatory 
BBa_K3702078BIOFAB Random Promoter apFAB22836BIOFAB -1Regulatory 
BBa_K3702079BIOFAB Random Promoter apFAB22536BIOFAB -1Regulatory 
BBa_K3702080BIOFAB Random Promoter apFAB22436BIOFAB -1Regulatory 
BBa_K3702081BIOFAB Random Promoter apFAB32435BIOFAB -1Regulatory 
BBa_K3702082BIOFAB Random Promoter apFAB23036BIOFAB -1Regulatory 
BBa_K3702083BIOFAB Random Promoter apFAB31836BIOFAB -1Regulatory 
BBa_K3702084BIOFAB Random Promoter apFAB33136BIOFAB -1Regulatory 
BBa_K3702085BIOFAB Random Promoter apFAB30436BIOFAB -1Regulatory 
BBa_K3702086BIOFAB Random Promoter apFAB23136BIOFAB -1Regulatory 
BBa_K3702087BIOFAB Random Promoter apFAB22736BIOFAB -1Regulatory 
BBa_K3702088BIOFAB Random Promoter apFAB20936BIOFAB -1Regulatory 
BBa_K3702089BIOFAB Random Promoter apFAB20236BIOFAB -1Regulatory 
BBa_K3702090BIOFAB Random Promoter apFAB21235BIOFAB -1Regulatory 
BBa_K3702091BIOFAB Random Promoter apFAB21136BIOFAB -1Regulatory 
BBa_K3702092BIOFAB Random Promoter apFAB22136BIOFAB -1Regulatory 
BBa_K3702093BIOFAB Random Promoter apFAB20536BIOFAB -1Regulatory 
BBa_K3702094BIOFAB Random Promoter apFAB20136BIOFAB -1Regulatory 
BBa_K3702095BIOFAB Random Promoter apFAB19336BIOFAB -1Regulatory 
BBa_K3702096BIOFAB Random Promoter apFAB20336BIOFAB -1Regulatory 
BBa_K3702097BIOFAB Random Promoter apFAB20035BIOFAB -1Regulatory 
BBa_K3702098BIOFAB Random Promoter apFAB20736BIOFAB -1Regulatory 
BBa_K3702099BIOFAB Random Promoter apFAB20636BIOFAB -1Regulatory 
BBa_K3702101BIOFAB Random Promoter apFAB20836BIOFAB -1Regulatory 
BBa_K3702102BIOFAB Random Promoter apFAB18136BIOFAB -1Regulatory 
BBa_K3702103BIOFAB Random Promoter apFAB20436BIOFAB -1Regulatory 
BBa_K3702104BIOFAB Random Promoter apFAB19035BIOFAB -1Regulatory 
BBa_K3702105BIOFAB Random Promoter apFAB18935BIOFAB -1Regulatory 
BBa_K3702106BIOFAB Random Promoter apFAB18436BIOFAB -1Regulatory 
BBa_K3702107BIOFAB Random Promoter apFAB21535BIOFAB -1Regulatory 
BBa_K3702108BIOFAB Random Promoter apFAB16835BIOFAB -1Regulatory 
BBa_K3702109BIOFAB Random Promoter apFAB19735BIOFAB -1Regulatory 
BBa_K3702110BIOFAB Random Promoter apFAB19935BIOFAB -1Regulatory 
BBa_K3702111BIOFAB Random Promoter apFAB21636BIOFAB -1Regulatory 
BBa_K3702112BIOFAB Random Promoter apFAB18036BIOFAB -1Regulatory 
BBa_K3702113BIOFAB Random Promoter apFAB18736BIOFAB -1Regulatory 
BBa_K3702114BIOFAB Random Promoter apFAB18236BIOFAB -1Regulatory 
BBa_K3702115BIOFAB Random Promoter apFAB18636BIOFAB -1Regulatory 
BBa_K3702116BIOFAB Random Promoter apFAB18336BIOFAB -1Regulatory 
BBa_K3702117BIOFAB Random Promoter apFAB19536BIOFAB -1Regulatory 
BBa_K3702118BIOFAB Random Promoter apFAB16736BIOFAB -1Regulatory 
BBa_K3702119BIOFAB Random Promoter apFAB17736BIOFAB -1Regulatory 
BBa_K3702120BIOFAB Random Promoter apFAB19236BIOFAB -1Regulatory 
BBa_K3702121BIOFAB Random Promoter apFAB22035BIOFAB -1Regulatory 
BBa_K3702122BIOFAB Random Promoter apFAB16136BIOFAB -1Regulatory 
BBa_K3702123BIOFAB Random Promoter apFAB16036BIOFAB -1Regulatory 
BBa_K3702124BIOFAB Random Promoter apFAB16236BIOFAB -1Regulatory 
BBa_K3702125BIOFAB Random Promoter apFAB15936BIOFAB -1Regulatory 
BBa_K3702126BIOFAB Random Promoter apFAB16436BIOFAB -1Regulatory 
BBa_K3702127BIOFAB Random Promoter apFAB16636BIOFAB -1Regulatory 
BBa_K3702128BIOFAB Random Promoter apFAB15736BIOFAB -1Regulatory 
BBa_K3702129BIOFAB Random Promoter apFAB21735BIOFAB -1Regulatory 
BBa_K3702130BIOFAB Random Promoter apFAB15636BIOFAB -1Regulatory 
BBa_K3702131BIOFAB Random Promoter apFAB21336BIOFAB -1Regulatory 
BBa_K3702132BIOFAB Random Promoter apFAB32535BIOFAB -1Regulatory 
BBa_K3702133BIOFAB Random Promoter apFAB18835BIOFAB -1Regulatory 
BBa_K3702134BIOFAB Random Promoter apFAB21035BIOFAB -1Regulatory 
BBa_K3702135BIOFAB Random Promoter apFAB32736BIOFAB -1Regulatory 
BBa_K3702136BIOFAB Random Promoter apFAB29436BIOFAB -1Regulatory 

Terminators Table Generated by the Registry


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K3702150BIOFAB Terminator apFAB365108BIOFAB -1Terminator 
BBa_K3702137BIOFAB Terminator apFAB35286BIOFAB -1Terminator 
BBa_K3702138BIOFAB Terminator apFAB35350BIOFAB -1Terminator 
BBa_K3702139BIOFAB Terminator apFAB35433BIOFAB -1Terminator 
BBa_K3702140BIOFAB Terminator apFAB35580BIOFAB -1Terminator 
BBa_K3702141BIOFAB Terminator apFAB356121BIOFAB -1Terminator 
BBa_K3702142BIOFAB Terminator apFAB35752BIOFAB -1Terminator 
BBa_K3702143BIOFAB Terminator apFAB35831BIOFAB -1Terminator 
BBa_K3702144BIOFAB Terminator apFAB35983BIOFAB -1Terminator 
BBa_K3702145BIOFAB Terminator apFAB36040BIOFAB -1Terminator 
BBa_K3702146BIOFAB Terminator apFAB361105BIOFAB -1Terminator 
BBa_K3702147BIOFAB Terminator apFAB36280BIOFAB -1Terminator 
BBa_K3702148BIOFAB Terminator apFAB36391BIOFAB -1Terminator 
BBa_K3702149BIOFAB Terminator apFAB364102BIOFAB -1Terminator 
BBa_K3702151BIOFAB Terminator apFAB366109BIOFAB -1Terminator 
BBa_K3702152BIOFAB Terminator apFAB36783BIOFAB -1Terminator 
BBa_K3702153BIOFAB Terminator apFAB36896BIOFAB -1Terminator 
BBa_K3702154BIOFAB Terminator apFAB369106BIOFAB -1Terminator 
BBa_K3702155BIOFAB Terminator apFAB37097BIOFAB -1Terminator 
BBa_K3702156BIOFAB Terminator apFAB37193BIOFAB -1Terminator 
BBa_K3702157BIOFAB Terminator apFAB37291BIOFAB -1Terminator 
BBa_K3702158BIOFAB Terminator apFAB37384BIOFAB -1Terminator 
BBa_K3702159BIOFAB Terminator apFAB374104BIOFAB -1Terminator 
BBa_K3702160BIOFAB Terminator apFAB37580BIOFAB -1Terminator 
BBa_K3702161BIOFAB Terminator apFAB37634BIOFAB -1Terminator 
BBa_K3702162BIOFAB Terminator apFAB37791BIOFAB -1Terminator 
BBa_K3702163BIOFAB Terminator apFAB37891BIOFAB -1Terminator 
BBa_K3702164BIOFAB Terminator apFAB37985BIOFAB -1Terminator 
BBa_K3702165BIOFAB Terminator apFAB38085BIOFAB -1Terminator 
BBa_K3702166BIOFAB Terminator apFAB38190BIOFAB -1Terminator 
BBa_K3702167BIOFAB Terminator apFAB38287BIOFAB -1Terminator 
BBa_K3702168BIOFAB Terminator apFAB38388BIOFAB -1Terminator 
BBa_K3702169BIOFAB Terminator apFAB38491BIOFAB -1Terminator 
BBa_K3702170BIOFAB Terminator apFAB38587BIOFAB -1Terminator 
BBa_K3702171BIOFAB Terminator apFAB38685BIOFAB -1Terminator 
BBa_K3702172BIOFAB Terminator apFAB38791BIOFAB -1Terminator 
BBa_K3702173BIOFAB Terminator apFAB38839BIOFAB -1Terminator 
BBa_K3702174BIOFAB Terminator apFAB38991BIOFAB -1Terminator 
BBa_K3702175BIOFAB Terminator apFAB39089BIOFAB -1Terminator 
BBa_K3702176BIOFAB Terminator apFAB39182BIOFAB -1Terminator