Coding

Part:BBa_K2040122

Designed by: Chilam Poon   Group: iGEM16_NYMU-Taipei   (2016-10-14)


KillerRed + NLS

A SV40 nuclear localization signal(NLS) was fused to the phototoxic protein KillerRed.

Usage and Biology

KillerRed(BBa_K1184000) is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). It is engineered from anm2CP to be phototoxic. Expression of KillerRed and irradiation with light may act a kill-switch for biosafety applications. More details about KillerRed see 2013 Carnegie_Mellon.

KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival[2]. The following two ways have been found to be effective for killing the eukaryotic cells using KillerRed: (1) via an apoptotic pathway using KillerRed targeted to mitochondria, and (2) via membrane lipid oxidation using membrane-localized KillerRed. [2]

Chromatin is also a ROS-sensitive intracellular localization.So we designed to fuse a SV40 nuclear localization signal to KillerRed protein in order to increase efficiency of KillerRed-mediated oxidative stress.

So we tried to fused a SV40 nuclear localization signal(5' CCTCCCAAGAAGAAGCGCAAGGTC 3') to the KillerRed protein in order to target the chromatin in nucleus.

References

[1]2013 Carnegie_Mellon ;http://2013.igem.org/Team:Carnegie_Mellon/KillerRed

[2]Genetically-encoded photosensitizer KillerRed; http://evrogen.com/products/KillerRed/KillerRed_Detailed_description.shtml


Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 714
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 151
    Illegal BsaI.rc site found at 442


[edit]
Categories
//biosafety
//biosafety/kill_switch
//cds/reporter/rfp
//function/celldeath
//function/reporter/fluorescence
Parameters
colorRed
controlBBa_E1010 as a negative control
emission611 nm
excitation545-585 nm
functionPhototoxicity
originEngineered from anm2CP
outputSuperoxide radical anion
targetNucleus