Coding

Part:BBa_K1351017

Designed by: Philipp Popp & Roman Herzog   Group: iGEM14_LMU-Munich   (2014-09-09)

SdpI with RBS: Immunity against the cannibalsim toxin sdpC of B. subtilis

This gene codes for the immunity against the cannibalism toxin SDP of Bacillus subtilis. The sdpI gene is regulated by a separate promoter (PsdpRI) which is responsible for the operon sdpRI. Cannibalsim toxins are produced by B. subtilis mainly in mid to late stationary phase when nutrients are limited. We wanted to evaluate the immunity in order to later on interfere with it for our suicide module. For more details about our interference strategies please check our antisense RNA BBa_K1351019 and our small RNA fsrA BBa_K1351022.



Prefix: TGCAGAATTCGCGGCCGCTTCTAGAGTAAGGAGGAACTACT
Suffix: TACTAGTAGCGGCCGCTGCAGGCT
Results: LMU-2014-Results
This part is used in the 2014 LMU-Munich iGEM project BaKillus.



First results of this BioBrick are depicted in the following graph:

LMU14Sdpi.PNG

The graph shows growth curves of Bacillus subtilis W168 wildtype, a sdpI mutant strain as well as a sdpI mutant strain carrying our BioBrick BBa_K1351017. The results were performed with our protocoll: Lumi Assay in MCSE and consist of three replicas of three measurements. The induction was performed with 0.2% xylose. These results clearly show that our BioBrick BBa_K1351017 is functional and recovers wild type growth behavior.


Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
//cds
//chassis/prokaryote/bsubtilis
Parameters
n/aSdpI with RBS: Immunity against the cannibalsim toxin sdpC of B. subtilis