Coding

Part:BBa_K1351012

Designed by: Carolin Kobras   Group: iGEM14_LMU-Munich   (2014-09-10)

spaS Subtilin (antimicrobial peptide, Freiburg standard)

Subtilin Lanthionine-containing peptide antibiotic (lantibiotic) active on Gram-positive bacteria. The bactericidal activity of lantibiotics is based on depolarization of energized bacterial cytoplasmic membranes, initiated by the formation of aqueous transmembrane pores.

This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with AgeI, SpeI, NotI and PstI: ACCGGTTAATACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.


This part is used in the 2014 LMU-Munich iGEM project BaKillus.

Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
//cds
//chassis/prokaryote/bsubtilis
//collections/antimicrobial
Parameters
None