Coding

Part:BBa_K1351011

Designed by: Mona Dotzler   Group: iGEM14_LMU-Munich   (2014-10-05)

Bacillus subtilis sortase YhcS

Bacillus subtilis sortase YhcS (UniProt P54603), responsible for anchoring its substrae YhcR (UniProt P54602) covalently to the peptidoglycan wall of B. subtilis.

A YhcR-based surface display system has been shown to covalently anchor heterologous proteins to the B. subtilis cell wall (Liew et. al., 2012). It was used in the BaKillus project to display pathogen-specific peptides and mediate adhesion of B. subtlis to pathogens.

It consists of four components: the sortase substrate with a signal peptide (BBa_K1351008), a linker (BBa_K1351009) and a cell wall-anchoring domain (BBa_K1351010) as well as the sortase YhcS itself (this part), whose overexpression increases the efficiency of the surface display.


This part was generated in RFC10 with the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with SpeI, NotI and PstI: TACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV in orange. Shine-Dalgarno sequence and stop codons are underlined.


Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 34
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 199


[edit]
Categories
//cds
//chassis/prokaryote/bsubtilis
Parameters
None