Coding

Part:BBa_K1351008

Designed by: Mona Dotzler   Group: iGEM14_LMU-Munich   (2014-10-05)

Signal peptide of B. subtilis endonuclease YhcR

Signal peptide (amino acids 1 to 46) of Bacillus subtilis endonuclease YhcR (UniProt P54602). YhcR is secreted and covalently anchored to the petidoglycan wall by the sortase YhcS. Despite its signal protein of RR-type, which is typical for proteins exported via the Tat pathway, export of YhcR is not Tat-dependent and seems to function via the Sec pathway (Tjalsma et. al., 2004).

A YhcR-based surface display system has been shown to covalently anchor heterologous proteins to the B. subtilis cell wall (Liew et. al., 2012). It was used in the BaKillus project to display pathogen-specific peptides and mediate adhesion of B. subtilis to pathogens.

It consists of four components: the sortase substrate with a signal peptide (this part), a linker (BBa_K1351009) and a cell wall-anchoring domain (BBa_K1351010) as well as the sortase YhcS itself (BBa_K1351011), whose overexpression increases the efficiency of the surface display.


This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with AgeI, SpeI, NotI and PstI: ACCGGTTAATACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.

Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
//cds
//chassis/prokaryote/bsubtilis
Parameters
None