Coding

Part:BBa_K1351007

Designed by: Mona Dotzler   Group: iGEM14_LMU-Munich   (2014-10-05)

CWB domain of B. subtilis minor autolysin LytE

Cell wall binding domain and signal peptide (amino acids 1 to 207) of Bacillus subtilis minor autolysin LytE (probable peptidoglycan endopeptidase, Uniprot P54421). This domain has been used for displaying beta-lactamase on the cell surface of B. subtilis (Chen et. al., 2008). Used in the BaKillus project to display pathogen-specific peptides to mediate adhesion of B. subtilis to pathogens.


This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with AgeI, SpeI, NotI and PstI: ACCGGTTAATACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.


Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
//cds
//chassis/prokaryote/bsubtilis
Parameters
None