Coding

Part:BBa_K1351006

Designed by: Mona Dotzler   Group: iGEM14_LMU-Munich   (2014-10-04)

CWB domain of B. subtilis major autolysin LytC

Cell wall binding domain and signal peptide (amino acids 1 to 333) of Bacillus subtilis major autolysin LytC (N-acetylmuramoyl-L-alanine amidase, Uniprot Q02114). This domain has been used for displaying heterologous proteins on the cell surface of B. subtilis (Tsuchiya et. al., 1999). Used in the BaKillus project to display pathogen-specific peptides by C-terminal fusions to mediate adhesion of B. subtlis to pathogens.


This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with AgeI, SpeI, NotI and PstI: ACCGGTTAATACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.


Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
//cds
//chassis/prokaryote/bsubtilis
Parameters
None