Not Released
Experience: Works
Not Used
Get This Part
Coding

Part:BBa_K1351002

Designed by: Mona Dotzler   Group: iGEM14_LMU-Munich   (2014-10-03)

Chondroitin 4 sulfotransferase-derived peptide binding to NADH Oxidase of S. pneumoniae

Short peptide of 13 amino acids corresponding to amino acids 279 to 290 of the human protein Chondroitin 4 sulfotransferase (UniProt Q9NRB3). It has been shown to inhibit NADH oxidase (NOX) mediated binding of Streptococcus pneumoniae to human A549 cells (Muchnik et. al., 2013). Displayed on the surface of Bacillus subtilis, it should enable B. subtilis to bind specifically to S. pneumoniae.


This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with AgeI, SpeI, NotI and PstI: ACCGGTTAATACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.

Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
//cds
//chassis/prokaryote/bsubtilis
Parameters
None