Coding

Part:BBa_K1351000

Designed by: Mona Dotzler   Group: iGEM14_LMU-Munich   (2014-09-15)

beta-Neurexin-derived peptide binding to S. aureus adhesin SdrC

Short peptide of 11 amino acids corresponding to the N-terminus of the human protein neurexin beta-1. It includes the binding site (HHIHHFH) for Staphylococcus aureus adhesin SdrC. Displayed on the surface of Bacillus subtilis, it should enable B. subtilis to bind specifically to S. aureus.

This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with AgeI, SpeI, NotI and PstI: ACCGGTTAATACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.

This part is used in the 2014 LMU-Munich iGEM project BaKillus.

Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
//cds
//chassis/prokaryote/bsubtilis
Parameters
None