This tool is used to compare several sequencing reaction results to the expected sequece of a part.
The Registry Blast database was last updated on Thu Feb 20 04:44:18 2020. (Update now)

Sample:	Library: Spring 2019 Source Plates, Plate: SP 10029, Well: 5C 2019-06-10
Target part:	BBa_K1033926 (763 bp)   Linked from part info page vinoo
J23110 asPink K1033927

Sequence analysis of the Part in the Sample

Confirmed	All 763 bp of the part are confirmed by at least one sequencing read
	Confirmed Good: 763, Bad: 0, Not clear: 0, Not covered: 0
Part Reference
207920
207951

Sequence analysis of the Plasmid Backbone in the Sample

Confirmed
Plasmid Backbone: pSB1C3, Specified Resistance: C
This sample supports the BioBrick™ Standard Assembly assembly standard
Prefix: RFC[10] - BioBrick™ Standard Assembly at 1 gatttctggaattcgcggccgcttctagagtttacggcta ---------------------------------------- gatttctggaattcgcggccgcttctagagtttacggcta	Suffix: RFC[10] - BioBrick™ Standard Assembly at 763 taattaataatactagtagcggccgctgcagtccggcaaa taattaataatactagtagcggccgctgcagtccggcaaa taattaataatactagtagcggccgctgcagtcc------

Sequence Reads for Sequence Analysis 'Analysis for Well 120310'

207920	--Sequence 207920--	Blast against:	BBa_K1033926 Basic Parts All Parts
VR	Length: 1223bp	Get machine files:	SequenceTracePhred files: SequenceQualityTrace

207951	--Sequence 207951--	Blast against:	BBa_K1033926 Basic Parts All Parts
VF2	Length: 1137bp	Get machine files:	SequenceTracePhred files: SequenceQualityTrace