Yeast

< Back to Catalog

S. cerevisiae, a species of budding yeast, is a convenient chassis for engineered biological systems for several reasons.

  • It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology.
  • As a single celled organism S. cerevisiae is small with a short generation time (doubling time 1.5–2 hours at 30°C) and can be easily cultured.
  • S. cerevisiae can be transformed allowing for either the addition of new genes or deletion through homologous recombination. Furthermore, The ability to grow S. cerevisiae as a haploid simplifies the creation of gene knockouts strains.
  • As a eukaryote, S. cerevisiae shares the complex internal cell structure of plants and animals without the high percentage of non-coding DNA that can confound research in higher eukaryotes.

As an aside, it is perhaps the most useful yeast owing to its use since ancient times in baking and brewing.

Plasmid backbones (?) Promoters (?) Kozak sequences (?) Protein domains (?) Protein coding sequences (?) Translational units (?) Terminators (?)
Help: Want to know more about Yeast? See the help pages for more information.

Plasmid backbones

BioBrickbackbonevspart.png

Plasmids are circular, double-stranded DNA molecules typically containing a few thousand base pairs that replicate within the cell independently of the chromosomal DNA. Plasmid DNA is easily purified from cells, manipulated using common lab techniques and incorporated into cells. Most BioBrick parts in the Registry are maintained and propagated on plasmids. Thus, construction of BioBrick parts, devices and systems usually requires working with plasmids.

Note: In the Registry, plasmids are made up of two distinct components:

  1. the BioBrick part, device or system that is located in the BioBrick cloning site, between (and excluding) the BioBrick prefix and suffix.
  2. the plasmid backbone which propagates the BioBrick part. The plasmid backbone is defined as the sequence beginning with the BioBrick suffix, including the replication origin and antibiotic resistance marker, and ending with the BioBrick prefix. [Note that the plasmid backbone itself can be composed of BioBrick parts.]

Many BioBrick parts in the Registry are maintained on more than one plasmid backbone!

Note that most of these plasmid backbones comply with the Lim lab AarI part assembly standard. See the 2008 UCSF iGEM team wiki for more details.


More...
NameDescriptionResistanceRepliconCopy
number
ChassisLength
BBa_J63010Protein fusion vector (Silver lab standard)A   3266
BBa_K106006AarI AD acceptor vector (pRS315, Adh1P, Adh1t)    7650
BBa_K106014AarI AD acceptor vector (pRS315, Cyc1P, Adh1t)    6397
BBa_K106670AarI AD acceptor, pRS315, 8X LexAOPs Cyc1P, Adht1    6559
BBa_K106672AarI AD acceptor vector (pRS305, Gal1P, Adh1t)    6638
BBa_K106693 AarI A!D acceptor vector (pRS315, Cyc1P, Adh1t)     7650
BBa_K106697AarI AD acceptor vector (pRS315, Cyc1P, Adh1t-8XLexA Ops)    6559
BBa_K106698AarI AD acceptor vector (pRS315, 8X LexAOps Fig1P, Adh1t)    7364
BBa_K1680014pRS313 yeast shuttle vector with Biobrick MCS    4928
BBa_K1680015pRS315 yeast shuttle vector with Biobrick MCS    5979
BBa_K1680016pRS316 yeast shuttle vector with Biobrick MCS    4848
BBa_K319043ADE4 targeting vector    2508
BBa_K394001Plasmid for Chromosomal Integration in Yeast at His3    3457
BBa_K394002Plasmid for Chromosomal Integration in Yeast at Ura3    3458
BBa_K555009pYES2 - galactose-inducible expression vector for yeast    5856
BBa_K801000pTUM100 yeast shuttle vector based on pYES2    4923
BBa_K801001pTUM101 yeast shuttle vector with pTEF1 promoter    5315
BBa_K801002pTUM102 yeast shuttle vector with pTEF2 promoter    5514
BBa_K801003pTUM103 yeast shuttle vector with pADH1 promoter    5585
BBa_K801004pTUM104 yeast shuttle vector with GAL1 promoter    5837


SergioPeisajovichPhoto.jpg AndrewHorowitzPhoto.jpg Sergio Peisajovich and Andrew Horowitz, from Wendell Lim's lab, developed several of the yeast plasmid backbones as an instructor of the 2008 UCSF iGEM team.

Promoters

The registry symbol for a promoter is shown above a typical sequence for a bacterial promoter. The lavender shaded boxes indicate the two most conserved regions of a bacterial promoter and are located at -10 and -35 bases from the transcriptional start site (shaded in green). There are, on average, 17bp between the -10 and -35 sites and 7bp between the -10 site and the transcriptional start site pribnowharleylisser1lisser2.

A promoter is a DNA sequence that can recruit transcriptional machinery and lead to transcription of the downstream DNA sequence. The specific sequence of the promoter determines the strength of the promoter (a strong promoter leads to a high rate of transcription initiation).

In addition to sequences that "promote" transcription, a promoter may include additional sequences known as operators that control the strength of the promoter. For example, a promoter may include a binding site for a protein that attracts or obstructs the RNAP binding to the promoter. The presence or absence of the protein will affect the strength of the promoter. Such a promoter is known as a regulated promoter.

Constitutive

ConstitutivePromoter.png

All the promoters on this page are yeast promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcriptional regulators. If you find any promoters on this page that you know to be regulated by a particular transcription factor, please let us know, or re-categorize the part yourself!


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I766555pCyc (Medium) Promoter . . . acaaacacaaatacacacactaaattaata2443344Not in stock
BBa_I766556pAdh (Strong) Promoter . . . ccaagcatacaatcaactatctcatataca15013301Not in stock
BBa_I766557pSte5 (Weak) Promoter . . . gatacaggatacagcggaaacaacttttaa6013594Not in stock
BBa_J63005yeast ADH1 promoter . . . tttcaagctataccaagcatacaatcaact14452344It's complicated
BBa_K105027cyc100 minimal promoter . . . cctttgcagcataaattactatacttctat1031876It's complicated
BBa_K105028cyc70 minimal promoter . . . cctttgcagcataaattactatacttctat1031833It's complicated
BBa_K105029cyc43 minimal promoter . . . cctttgcagcataaattactatacttctat1031832It's complicated
BBa_K105030cyc28 minimal promoter . . . cctttgcagcataaattactatacttctat1031832It's complicated
BBa_K105031cyc16 minimal promoter . . . cctttgcagcataaattactatacttctat1031832It's complicated
BBa_K122000pPGK1 . . . ttatctactttttacaacaaatataaaaca14971440It's complicated
BBa_K124000pCYC Yeast Promoter . . . acaaacacaaatacacacactaaattaata2882076Not in stock
BBa_K124002Yeast GPD (TDH3) Promoter . . . gtttcgaataaacacacataaacaaacaaa6814340Not in stock
BBa_K319005yeast mid-length ADH1 promoter . . . ccaagcatacaatcaactatctcatataca7203236It's complicated
BBa_M31201Yeast CLB1 promoter region, G2/M cell cycle specific . . . accatcaaaggaagctttaatcttctcata5001858Not in stock


Positively regulated

PositivePromoter.png

All the promoters on this page are yeast promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.



More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_J63006yeast GAL1 promoter . . . gaggaaactagacccgccgccaccatggag54911798In stock
BBa_K392001yeast ENO2 promoter . . . aagcaactaatactataacatacaataata5982244It's complicated
BBa_K586000Cup-1 Heavy metal sensor . . . accaagaagtcatgctgctctgggaaatga1861888It's complicated
BBa_K753000Yeast FIG1 promoter . . . aaacaaacaaacaaaaaaaaaaaaaaaaaa4502409It's complicated
BBa_K2294007Synthtic minimal Galactose induced promoter + Kozak sequence . . . atcgaaaaaagtctccatggtggcggcggg1606028It's complicated
BBa_K2601000Promoter-Tet07(Saccharomyces cerevisiae) . . . cacacactaaattacccggatcaattcggg7241597It's complicated
BBa_J24813URA3 Promoter from S. cerevisiae . . . gcacagacttagattggtatatatacgcat1371431Not in stock
BBa_K110004Alpha-Cell Promoter Ste3 . . . gggagccagaacgcttctggtggtgtaaat5011372Not in stock
BBa_K110014A-Cell Promoter MFA2 (backwards) . . . atcttcatacaacaataactaccaacctta5501304Not in stock
BBa_K110015A-Cell Promoter MFA1 (RtL) . . . cttcatatataaaccgccagaaatgaatta4361659Not in stock
BBa_K284003Partial DLD Promoter from Kluyveromyces lactis . . . aagtgcaagaaagaccagaaacgcaactca4631735It's complicated
BBa_K284002JEN1 Promoter from Kluyveromyces lactis . . . gagtaaccaaaaccaaaacagatttcaacc9981654It's complicated
BBa_K2601001Promoter-PDH3(Saccharomyces cerevisiae) . . . gtttcgaataaacacacataaacaaacaaa5001762In stock
BBa_K110005Alpha-Cell Promoter MF(ALPHA)2 . . . aaattccagtaaattcacatattggagaaa5001771It's complicated
BBa_K110006Alpha-Cell Promoter MF(ALPHA)1 . . . tttcatacacaatataaacgattaaaagaa5011773It's complicated
BBa_K110016A-Cell Promoter STE2 (backwards) . . . accgttaagaaccatatccaagaatcaaaa5002256It's complicated
BBa_K165001pGAL1+ w/XhoI sites . . . atactttaacgtcaaggagaaaaaactata6722730It's complicated
BBa_K165030mCYC promoter plus Zif268-HIV binding sites . . . cacaaatacacacactaaattaataactag3071723It's complicated
BBa_K165031mCYC promoter plus LexA binding sites . . . cacaaatacacacactaaattaataactag4031564It's complicated
BBa_K165034 Zif268-HIV bs + LexA bs + mCYC promoter . . . cacaaatacacacactaaattaataactag4571431It's complicated
BBa_K165041 Zif268-HIV binding sites + TEF constitutive yeast promoter . . . atacggtcaacgaactataattaactaaac4571163It's complicated
BBa_K106699Gal1 Promoter . . . aaagtaagaatttttgaaaattcaatataa6861216Not in stock


Repressible

NegativePromoter.png

All the promoters on this page are yeast promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K950000yeast fet3 promotor . . . cagtgtaaggaagagtagcaaaaaattaga5754852In stock
BBa_K950002yeast anb1 promotor . . . atacacctatttcattcacacactaaaaca3995683In stock
BBa_K165000MET 25 Promoter . . . tagatacaattctattacccccatccatac3871534It's complicated
BBa_K950003yeast suc2 promotor . . . aaaaagcttttcttttcactaacgtatatg6995148It's complicated
BBa_I766558pFig1 (Inducible) Promoter . . . aaacaaacaaacaaaaaaaaaaaaaaaaaa10002141Not in stock
BBa_I766214pGal1 . . . atactttaacgtcaaggagaaaaaactata10021190Not in stock


Multiply regulated

MultiplePromoter.png

This page lists yeast promoters that are Multi-regulated meaning that each promoter is either positively or negatively regulated by multiple transcription factors (other than the sigma factor). For example, a promoter negatively regulated by two repressor proteins forms the basis of a nor gate, the presence of either or both repressors is sufficient to produce a low output from the promoter. These promoters are useful if, for example, you are looking to build logic gates, or if you are looking to build a system where expression of a gene must be dependent on multiple environmental factors.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I766200pSte2 . . . accgttaagaaccatatccaagaatcaaaa10001207Not in stock
BBa_K110016A-Cell Promoter STE2 (backwards) . . . accgttaagaaccatatccaagaatcaaaa5002256It's complicated
BBa_K165034 Zif268-HIV bs + LexA bs + mCYC promoter . . . cacaaatacacacactaaattaataactag4571431It's complicated
BBa_K165041 Zif268-HIV binding sites + TEF constitutive yeast promoter . . . atacggtcaacgaactataattaactaaac4571163It's complicated
BBa_K165043 Zif268-HIV binding sites + MET25 constitutive yeast promoter . . . tagatacaattctattacccccatccatac4411163It's complicated


Kozak sequences

A sequence logo showing the most conserved bases around the initiation codon from all human mRNAs.

Yeast RBSs, more often known as Kozak sequences, are designed to be recognized by the yeast ribosome. As a eukaryotic translation signal, the sequence of yeast RBSs are distinct from prokaryotic RBSs. The registry collection of yeast RBSs is currently small, we need your help! Please contribute new yeast RBSs to the registry or provide further information about our existing yeast RBSs.



More...
NameSequenceDescriptionRelative
Strength
Predicted
Strength
BBa_J63003cccgccgccaccatggagdesigned yeast Kozak sequencen/a 
BBa_K165002cccgccgccaccatggagKozak sequence (yeast RBS)  
BBa_K792001ggatccacgattaaaagaatgKozak sequence from yeast α-factor mating pheromone (MFα1)  


Protein tags and modifiers

Protein domains encode portions of proteins and can be assembled together to form translational units, a genetic part spanning from translational initiation (the RBS) to translational termination (the stop codon).

ProteinDomains.png

There are several different types of protein domains.

  1. Head Domain: The Head domain consists of the start codon followed immediately by zero or more triplets specifiying an N-terminal tag, such as a protein export tag or lipoprotein binding tag. Head domains should begin with an ATG start codon and include codons 2 and 3 of the protein at a minimum. Examples of head domains include
    • ATG start codon
    • ATG start codon and codons 2-3
    • ATG start codon and signal sequence
    • ATG start codon and affinity tag
  2. Internal Domains: Protein domains consist of a series of codon triplets coding for an amino acid sequence without a start codon or stop codon. Multiple Internal Domains can be fused. Examples of internal domains include
    • DNA binding domains
    • Dimerization domains
    • Kinase domains
  3. Special Internal Domains: Short Domains with specific function may be separately categorized, but obey the same composition rules as normal internal domains. Examples of special internal domains include
    • Linkers
    • Cleavage sites
    • Inteins
  4. Tail Domain: The C-terminus of a coding region consists of zero or more triplet codons, followed by a pair of TAA stop codons. In the simplest case, the stop codons terminate the protein with an Stop. More complex Tails may include degradation tags appropriate to the organism (i.e., with different degradation rates). Examples of Tail domain include
    • TAATAA stop codons
    • A degradation tag followed by TAATAA stop codons
    • An affinity tag followed by TAATAA stop codon

Unfortunately, the original BioBrick assembly standard, Assembly standard 10, does not support in-frame assembly of protein domains. (Assembly standard 10 creates an 8 bp scar between adjacent parts.) Therefore, it is recommended that you use an alternate approach to assemble protein domains together to make a translational unit. There are several possible approaches to assembling protein domains including direct synthesis (preferred because it creates no scars) as well as various assembly standards. Regardless of which standard you choose, we suggest that the resulting protein coding sequence or translational unit comply with the original BioBrick assembly standard so that your parts can be assembled with most of the parts in the Registry.


Protein coding sequences should be as follows

GAATTC GCGGCCGC T TCTAG [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG


Note: Although most RBSs are currently specified as separate parts in the Registry, we are now moving to a new design in which the RBS and Head domain are combined into a single part termed a Translational start. The new design has the advantage of encapsulating both ribosome binding and translational initiation within a single part. Our working hypothesis is that the new design will reduce the likelihood of unexpected functional composition problems between the RBS and coding sequence.


More...
NameDescriptionAA sequenceLength
BBa_J63007PKI nuclear export sequence; yeast codon optimized 30
BBa_J63008SV40 nuclear localization sequence from SV40; yeast codon optimized 21
BBa_K105013cin8 - cell cycle specific degradation tag in yeast 228
BBa_K105015hsl1 - cell cycle dependent degradation tag in yeast 618
BBa_K1486026sfGFP + Kanamycin resistance for yeast 2535
BBa_K1486027R.reniformis luciferase + ADH1 terminator + Kanamycin resistance 2681
BBa_K1486028Yeast optimized sfGFP N-terminus (1-214) 642
BBa_K1486033R.reniformis luciferase + ADH1 terminator + CaUra3 2523
BBa_K1486034Yeast optimized superfolder GFP C-terminus (215-238) 75
BBa_K1486035Yeast Optimized sfGFP-C + ADH1 terminator + CaUra3 Cassette 1662
BBa_K1486036rLucC + ADH1 terminator + CaUra3 cassette 2193
BBa_K1680004SV40 NLS 24
BBa_K416000Aga2 CDS Responsible for Yeast Surface Display 261
BBa_K416003Yeast Secretion Tag 114
BBa_K792002Secretion tag from yeast α-factor mating pheromone (MFα1) 54


Protein coding sequences

Protein coding sequences are DNA sequences that are transcribed into mRNA and in which the corresponding mRNA molecules are translated into a polypeptide chain. Every three nucleotides, termed a codon, in a protein coding sequence encodes 1 amino acid in the polypeptide chain. In some cases, different chassis may either map a given codon to a different sequence or may use different codons more or less frequently. Therefore some protein coding sequences may be optimized for use in a particular chassis.

In the Registry, protein coding sequences begin with a start codon (usually ATG) and end with a stop codon (usually with a double stop codon TAA TAA). Protein coding sequences are often abbreviated with the acronym CDS.

Although protein coding sequences are often considered to be basic parts, in fact proteins coding sequences can themselves be composed of one or more regions, called protein domains. Thus, a protein coding sequence could either be entered as a basic part or as a composite part of two or more protein domains.

  1. The N-terminal domain of a protein coding sequence is special in a number of ways. First, it always contains a start codon, spaced at an appropriate distance from a ribosomal binding site. Second, many coding regions have special features at the N terminus, such as protein export tags and lipoprotein cleavage and attachment tags. These occur at the beginning of a coding region, and therefore are termed Head domains.
  2. A protein domain is a sequence of amino acids which fold relatively independently and which are evolutionarily shuffled as a unit among different protein coding regions. The DNA sequence of such domains must maintain in-frame translation, and thus is a multiple of three bases. Since these protein domains are within a protein coding sequence, they are called Internal domains. Certain Internal domains have particular functions in protein cleavage or splicing and are termed Special Internal domains.
  3. Similarly, the C-terminal domain of a protein is special, containing at least a stop codon. Other special features, such as degradation tags, are also required to be at the extreme C-terminus. Again, these domains cannot function when internal to a coding region, and are termed Tail domains.

For more details on protein domains including how to assemble protein domains into protein coding sequences, please see Protein domains.


Protein coding sequences should be as follows

GAATTC GCGGCCGC T TCTAG [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG


More...
NameProteinDescriptionTagDirectionUniProtKEGGLengthStatus
BBa_E2050mOrangederivative of mRFP1, yeast-optimizedNone  769In stock
BBa_K106001 Sir4, Aar1 AD part  4077It's complicated
BBa_K106002 Sir2, Aar1 AB part  1686It's complicated
BBa_K106003 Sir2, Aar1 BD part  1686It's complicated
BBa_K106011Sas2Sas2 histone acetyltransferase, Aar1 AB part  1017It's complicated
BBa_K106012Sas2Sas2 histone acetyltransferase, Aar1 BD part  1014It's complicated
BBa_K106013Esa1Esa1 histone acetyltransferase, Aar1 BD part  1338It's complicated
BBa_K1314017 Mid1 (S. cerevisae Codon Opt)  1680It's complicated
BBa_K1462000 CoxVI  120Not in stock
BBa_K1462010 coxIV  75Not in stock
BBa_K1462020 Erg10  1197Not in stock
BBa_K1462030 Hbd  849Not in stock
BBa_K1462050 Ccr  1344Not in stock
BBa_K1462060 AdhE2  2577Not in stock
BBa_K1592000 LIP2 prepro(signal peptide)  99In stock
BBa_K1611000 IFNgamma  471It's complicated
BBa_K1611001 MATalpha-IFNgamma  735It's complicated
BBa_K1611002 OVA1  66In stock
BBa_K1611004 DEC-205  801In stock
BBa_K165005 Venus YFP, yeast optimized for fusionForward  744In stock
BBa_K1680006 Fluorescent protein dronpa  669In stock
BBa_K1680007 Cre recombinase  1029In stock
BBa_K1680008 Δ1-19 Cre recombinase  972In stock
BBa_K1680009 NanoLuc Luciferase  516In stock
BBa_K1680010 Firefly Luciferase  1653In stock
BBa_K1680011 HCV protease with linkers  648In stock
BBa_K1680012 Cleavage site for HCV protease  36In stock
BBa_K1680013 NDegron  165In stock
BBa_K1680017 Cre-Dronpa Fusion  1728It's complicated
BBa_K1680018 Cre-Dronpa fusion  1746It's complicated
BBa_K1680019 Cre-dronpa fusion  1764It's complicated
BBa_K1680020 Cre-dronpa fusion  1782It's complicated
BBa_K1680021 Dronpa caged Cre with NLS  2433It's complicated
BBa_K1680022 Dronpa caged Cre with NLS  2451It's complicated
BBa_K1680023 Dronpa caged Cre with NLS  2469It's complicated
BBa_K1680024 Dronpa caged Cre with NLS  2487It's complicated
BBa_K1728021 Chemokine receptor 1 (CXCR1)   1053Not in stock
BBa_K1907000 Venus Yellow Fluorescent Protein  717It's complicated
BBa_K1907001 Microcystinase (MlrA) for S. cerevisiae  1038It's complicated
BBa_K1907006 Microcystinase (Mlra) + mating factor alpha tag, for S. cerevisiae  1305Not in stock
BBa_K1908001 Coding sequence for Homo sapien Cripto-1 membrane protein.  767It's complicated
BBa_K211002 RI7-odr10 chimeric GPCRFLAG  1062It's complicated
BBa_K2225000 AtNHXS1 for S. cerevisiae (Na+/H+ antiporter)  729It's complicated
BBa_K2225002 AtSultr1;2 for S.cerevisiae (high-affinity sulfate transporter )  1962It's complicated
BBa_K2247002 HXT2 glucose transpoter from S. cerevisiae  1623It's complicated
BBa_K2247003 GFP tagged HXT2 glucose transpoter from S. cerevisiae  2349It's complicated
BBa_K2247004 HXT5 glucose transpoter from S. cerevisiae  1776It's complicated
BBa_K2247005 GFP tagged HXT5 glucose transpoter from S. cerevisiae  2502It's complicated
BBa_K2256000sod2sod2 (Na+/H+antiporter) from Schizosaccharomyces pombe  657It's complicated
BBa_K2483007Ddx4-YFPDdx4-YFP  1710It's complicated
BBa_K2583006GPA1Coding sequence of GPA1 in yeast genome  1419It's complicated
BBa_K2601002 SUMO (Small Ubiquitin-like Modifier)  273It's complicated
BBa_K2601003 SIM (SUMO-Interaction Motif)  69It's complicated
BBa_K2601004 HOTag3 (Homo-Oligomeric Tag3)  90It's complicated
BBa_K2601005 HOTag6 (Homo-Oligomeric Tag6)  99It's complicated
BBa_K2637001 KaiA Protein of Circadian RhythmForward  858It's complicated
BBa_K2637002 KaiB Protein of Circadian RhythmForward  312It's complicated
BBa_K2637003 KaiC Protein of Circadian RhythmForward  1563It's complicated
BBa_K2637004 SasA Protein of Circadian RhythmForward  1167It's complicated
BBa_K2637005 CikA Protein of Circadian RhythmForward  2268It's complicated
BBa_K2637006 RpaA Protein of Circadian RhythmForward  753It's complicated
BBa_K2637007 AD-Activation Domain of Gal4 transcription factorsForward  402It's complicated
BBa_K2637008 BD-DNA-binding Domain of Gal4 transcription factorsForward  457It's complicated
BBa_K2637010 Nanoluc+PESTForward  642It's complicated
BBa_K2835005 His-tagged fungal laccase with start codon (ATG)6X His  1521It's complicated
BBa_K284000 Lactate Permease from Kluyveromyces lactis  1873Not in stock
BBa_K394000 Resistance Gene for G418 in Yeast  813It's complicated
BBa_K394003 Sex-Lethal from Drosophila melanogaster  1062Not in stock
BBa_K775000  RI7-GPR109A Niacin chimeric GPCR  1414In stock
BBa_K775003 RI7-odr10 (diacetyl) chimeric GPCR with promoter and terminator  1444In stock
BBa_K801039 SV40NLS-GAL4AD-linker-PIF3 (part for GAL4/LexA based light-switchable promoter system)  804In stock
BBa_K801040 SV40NLS-PhyB-linker-Gal4DBD (part for GAL4 based light switchable promoter system)  3294In stock
BBa_K801060 (+)-Limonene synthase 1 with Strep-tag and yeast consensus sequence.  1708In stock
BBa_K801061 (+)-Limonene synthase 1 coding region  1665In stock
BBa_K801070 xanthosine methyltransferase CaXMT1-strep  1158In stock
BBa_K801071 7-methylxanthine N-methyltransferase CaMXMT1-strep  1176In stock
BBa_K801072 3,7-dimethylxanthine N-methyltransferase CaDXMT1-strep  1194In stock
BBa_K801080 Prepro-Thaumatin, yeast codon optimized  708In stock
BBa_K801090 phenylalanine ammonia lyase (PAL) + yeast consensus sequence  2154In stock
BBa_K801091 phenylalanine ammonia lyase (PAL) coding region  2148In stock
BBa_K801092 4-coumarate - coenzym A ligase (4CL) + yeast consensus sequence  1692In stock
BBa_K801093 4-coumarate--coenzyme A ligase (4CL) coding region  1686In stock
BBa_K801094 Naringenin - chalcone synthase (CHS) + yeast consensus sequence  1176In stock
BBa_K801095 Naringenin - chalcone synthase (CHS) coding region  1170In stock
BBa_K801096 Aromatic prenyltransferase (APT) coding region  1233In stock
BBa_K801097 Chalcone O-methyltransferase (OMT1) + yeast consensus sequence  1062In stock
BBa_K801098 O-methyltransferase 1 (OMT1) coding region  1056In stock
BBa_K809401 REX coding sequence  777Not in stock
BBa_K950001 yeast rox1  1225In stock
BBa_K950009 yeast mig1  1515In stock
BBa_Y00029 S. pombe homolog of S.cerevisiae SGF29, recoded for expression in S.c.  794It's complicated
BBa_Y00073 S. pombe gene SPCC126.04c, coded for S. cerevisiae expression  1094It's complicated


Translational units

Translational units begin with the RBS, the site of ribosome binding and translational initiation, and end with a stop codon, the site of translational termination. Every translational unit in the Registry consists of at least three parts, a Translational start, one or more Internal Domains including Special Internal Domains, and a Tail Domain. Thus translational units can, in some sense, be thought of as a composite part made up of three or more parts. Protein coding sequences, in contrast, begin with a start codon and end with a stop codon.

ProteinDomains.png

For more information on protein domains, see protein domains. Unfortunately, the original BioBrick assembly standard, Assembly standard 10, does not support in-frame assembly of protein domains. (Assembly standard 10 creates an 8 bp scar between adjacent parts.) Therefore, it is recommended that you use an alternate approach to assemble protein domains together to make a translational unit. There are several possible approaches to assembling protein domains including direct synthesis (preferred because it creates no scars) as well as various assembly standards. Regardless of which standard you choose, we suggest that the resulting translational unit comply with the original BioBrick assembly standard so that your parts can be assembled with most of the parts in the Registry.


Translational units should be as follows

GAATTC GCGGCCGC T TCTAGA G [RBS] [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG


Although most RBSs are currently specified as separate parts in the Registry, we are now moving to a new design in which the RBS and Head domain are combined into a single part termed a Translational start. The new design has the advantage of encapsulating both ribosome binding and translational initiation within a single part. Our working hypothesis is that the new design will reduce the likelihood of unexpected functional composition problems between the RBS and coding sequence.


More...
NameProteinDescriptionTagDirectionUniProtKEGGLengthStatus
BBa_K165057 Kozak + mCherry  761It's complicated
BBa_K165058 Kozak + YFP  770It's complicated
BBa_K165059 Kozak + CFPx2   1520It's complicated
BBa_K976009 TDH3 Promoter + Yeast Kozak + FGFR-1/FRS2 Complex +TEF1 Terminator  5224Not in stock


Terminators

Here are all the yeast terminators available. As you can see, there are only a couple available, so please design, construct, and characterize new ones and submit them to the Registry!


More...
NameDescriptionDirectionEfficiency
Fwd. Rev.
ChassisLength
BBa_J63002ADH1 terminator from S. cerevisiaeForward   225
BBa_K110012STE2 terminatorForward   123
BBa_K1462070cyc1   250
BBa_K1486025ADH1 TerminatorForward  Saccharomyces Cerevisiae188
BBa_K2314608Tmini is a very short terminator in yeast. It's only 68bp in length but has a good performance.   68
BBa_K2637012ADH1 Terminator  S. cerevisiae335
BBa_K2637014TEF1 Terminator  S. cerevisiae476
BBa_K2637016PGK1 Terminator  S. cerevisiae285
BBa_K2637017CYC1 terminator   261
BBa_K392003yeast ADH1 terminator   129
BBa_K801011TEF1 yeast terminator   507
BBa_K801012ADH1 yeast terminator   349
BBa_Y1015CycE1   252


CarolineAjoFranklingPhoto.jpg
Caroline Ajo-Franklin developed the yeast terminator BBa_J63002 as a post-doc in Pam Silver's lab.

References