Promoters/Catalog/T7


Description

T7 promoters can produce high levels of transcription in E. coli when T7 RNAP is present. The second advantage of T7 promoters is that they are not recognized by E. coli RNAP making T7 promoters capable of independent regulation from E. coli promoters. Since an active strong T7 promoter can completely stop the growth of E. coli due to the high level of resource consumption (e.g. nucleotides) by the T7 RNAP, it is typically necessary to regulate the levels of either the T7 RNAP or the T7 promoter or both. As such the T7 promoter family contains both constitutive promoters and negatively regulated promoters that can be turned off by a repressor protein. The most common cell strain to use with a T7 promoter system is BL21(DE3) which is an E. coli B strain that contains a λ lysogen with an inducible T7 RNAP gene on the chromosome. However, it is possible to engineer many other E. coli strains to conditionally express T7 RNAP.

Obtaining the T7 promoter collection

The sequences of the T7 promoters can be found in the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the promoters are relatively short sequences, they can be ordered as two single-stranded overlapping oligo's are annealed and extended to construct the full promoters. See this OpenWetWare protocol on how to constructing parts via oligo annealing and extension. Alternatively the promoters can be ordered as short genes from a company such as Geneart.

Via the Registry distribution: Some of the promoters are available in the current registry distribution, see the availability column in the table below.

Design & Construction

The sequence logo for the strong promoters from the bacteriophage T7 genome.

The T7 promoters in the collection were designed and constructed by several different groups. However, there is only T7 RNAP and so only one kind of T7 promoter. The consensus sequence for T7 promoters can be inferred from the sequence logo for T7 promoters shown on the right.

T7 promoter collection


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I712074T7 promoter (strong promoter from T7 bacteriophage) . . . agggaatacaagctacttgttctttttgca461938In stock
BBa_I719005T7 Promotertaatacgactcactatagggaga237912In stock
BBa_J34814T7 Promotergaatttaatacgactcactatagggaga281190Not in stock
BBa_J64997T7 consensus -10 and resttaatacgactcactatagg1910154It's complicated
BBa_K113010overlapping T7 promoter . . . gagtcgtattaatacgactcactatagggg401553It's complicated
BBa_K113011more overlapping T7 promoter . . . agtgagtcgtactacgactcactatagggg371601It's complicated
BBa_K113012weaken overlapping T7 promoter . . . gagtcgtattaatacgactctctatagggg401630It's complicated
BBa_K1614000T7 promoter for expression of functional RNAtaatacgactcactatag185219In stock
BBa_K3511008C62-T7 promotertaatacgactcacaatcgcggag23 Not in stock
BBa_K3633015T7 promotertaatacgactcactatagg19 It's complicated
BBa_K525998Promoter T7 and RBS . . . atacgactcactatagggaaagaggagaaa323036In stock
BBa_R0085T7 Consensus Promoter Sequencetaatacgactcactatagggaga232072In stock
BBa_R0180T7 RNAP promoterttatacgactcactatagggaga231654Not in stock
BBa_R0181T7 RNAP promotergaatacgactcactatagggaga231651Not in stock
BBa_R0182T7 RNAP promotertaatacgtctcactatagggaga231653Not in stock
BBa_R0183T7 RNAP promotertcatacgactcactatagggaga231653Not in stock
BBa_R0184T7 promoter (lacI repressible) . . . ataggggaattgtgagcggataacaattcc441176Not in stock
BBa_R0185T7 promoter (lacI repressible) . . . ataggggaattgtgagcggataacaattcc441888Not in stock
BBa_R0186T7 promoter (lacI repressible) . . . ataggggaattgtgagcggataacaattcc441885Not in stock
BBa_R0187T7 promoter (lacI repressible) . . . ataggggaattgtgagcggataacaattcc441885Not in stock
BBa_Z0251T7 strong promoter . . . taatacgactcactatagggagaccacaac351887Not in stock
BBa_Z0252T7 weak binding and processivity . . . taattgaactcactaaagggagaccacagc351667Not in stock
BBa_Z0253T7 weak binding promoter . . . cgaagtaatacgactcactattagggaaga351400Not in stock

Characterization


Measured strengths