Promoters/Catalog/Ecoli/Positive

PositivePromoter.png

All the promoters on this page are E. coli promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.

Positively regulated E. coli σ70 promoters

This section lists promoters that are recognized by E. coli σ70 RNAP. σ70 is the major E. coli sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I0500Inducible pBad/araC promoter . . . gtttctccatacccgtttttttgggctagc121041577In stock
BBa_I1051Lux cassette right promoter . . . tgttatagtcgaatacctctggcggtgata681735In stock
BBa_I12006Modified lamdba Prm promoter (repressed by 434 cI) . . . attacaaactttcttgtatagatttaacgt825124In stock
BBa_I12007Modified lambda Prm promoter (OR-3 obliterated) . . . atttataaatagtggtgatagatttaacgt822240In stock
BBa_I12036Modified lamdba Prm promoter (cooperative repression by 434 cI) . . . tttcttgtatagatttacaatgtatcttgt912153In stock
BBa_I12040Modified lambda P(RM) promoter: -10 region from P(L) and cooperatively repressed by 434 cI . . . tttcttgtagatacttacaatgtatcttgt912572In stock
BBa_I12210plac Or2-62 (positive) . . . ctttatgcttccggctcgtatgttgtgtgg705361In stock
BBa_I13406Pbad/AraC with extra REN sites . . . ttttttgggctagcaagctttaccatggat12261484Not in stock
BBa_I13453Pbad promoter . . . tgtttctccataccgtttttttgggctagc13010492In stock
BBa_I14015P(Las) TetO . . . ttttggtacactccctatcagtgatagaga1701524In stock
BBa_I14016P(Las) CIO . . . ctttttggtacactacctctggcggtgata1681523In stock
BBa_I14017P(Rhl) . . . tacgcaagaaaatggtttgttatagtcgaa5113707In stock
BBa_I721001Lead Promoter . . . gaaaaccttgtcaatgaagagcgatctatg944214It's complicated
BBa_I723020Pu . . . ctcaaagcgggccagccgtagccgttacgc3202771It's complicated
BBa_I731004FecA promoter . . . ttctcgttcgactcatagctgaacacaaca90814Not in stock
BBa_I739104Double Promoter (LuxR/HSL, positive / P22 cII, negative) . . . gttctttaattatttaagtgttctttaatt1013261Not in stock
BBa_I739105Double Promoter (LuxR/HSL, positive / cI, negative) . . . cgtgcgtgttgataacaccgtgcgtgttga993259Not in stock
BBa_I741018Right facing promoter (for xylF) controlled by xylR and CRP-cAMP . . . gttacgtttatcgcggtgattgttacttat2213814In stock
BBa_I741019Right facing promoter (for xylA) controlled by xylR and CRP-cAMP . . . gcaaaataaaatggaatgatgaaactgggt1311268Not in stock
BBa_I741020promoter to xylF without CRP and several binding sites for xylR . . . gttacgtttatcgcggtgattgttacttat1911227Not in stock
BBa_I741021promoter to xylA without CRP and several binding sites for xylR . . . atttcacactgctattgagataattcacaa871248Not in stock
BBa_I746104P2 promoter in agr operon from S. aureus . . . agattgtactaaatcgtataatgacagtga961753In stock
BBa_I746360PF promoter from P2 phage . . . gacatctccggcgcaactgaaaataccact911290In stock
BBa_I746361PO promoter from P2 phage . . . gaggatgcgcatcgtcgggaaactgatgcc921522In stock
BBa_I746362PP promoter from P2 phage . . . catccgggactgatggcggaggatgcgcat921491It's complicated
BBa_I746363PV promoter from P2 phage . . . aacttttatatattgtgcaatctcacatgc911490Not in stock
BBa_I746364Psid promoter from P4 phage . . . tgttgtccggtgtacgtcacaattttctta931495In stock
BBa_I746365PLL promoter from P4 phage . . . gtctgctgaaaatattcacaaaataaagcg921606In stock
BBa_I751501plux-cI hybrid promoter . . . gtgttgatgcttttatcaccgccagtggta661222Not in stock
BBa_I751502plux-lac hybrid promoter . . . agtgtgtggaattgtgagcggataacaatt744200Not in stock
BBa_I760005Cu-sensitive promoteratgacaaaattgtcat1612396Not in stock
BBa_I761011CinR, CinL and glucose controlled promotor . . . acatcttaaaagttttagtatcatattcgt2952080It's complicated
BBa_I765001UV promoter . . . ctgaaagcgcataccgctatggagggggtt761381In stock
BBa_I765007Fe and UV promoters . . . ctgaaagcgcataccgctatggagggggtt11281238It's complicated
BBa_J01005pspoIIE promoter (spo0A J01004, positive) . . . aacgaatataacaggtgggagatgagagga2061794Not in stock
BBa_J03007Maltose specific promotor . . . aatatttcctcattttccacagtgaagtga2061442Not in stock
BBa_J06403RhIR promoter repressible by CI . . . tacgcaagaaaatggtttgttatagtcgaa511464In stock
BBa_J07007ctx promoter . . . atttaattgttttgatcaattatttttctg1452141Not in stock
BBa_J102001Reverse Lux Promoter . . . tcttgcgtaaacctgtacgatcctacaggt551785It's complicated
BBa_J13210pOmpR dependent POPS producer . . . attattctgcatttttggggagaatggact2451424In stock
BBa_J15502copA promoter . . . ccttgctggaaggtttaacctttatcacag2871367Not in stock
BBa_J16101BanAp - Banana-induced Promoteratgatgtgtccatggatta191545Not in stock
BBa_J16105HelPp - "Help" Dependant promoteratgatagacgatgtgcggacaacgtg261316Not in stock
BBa_J45503hybB Cold Shock Promoter . . . cattagccgccaccatggggttaagtagca3938199Not in stock
BBa_J58100AND-type promoter synergistically activated by cI and CRP . . . atttataaatagtggtgatagatttaacgt1063577It's complicated
BBa_J61051[Psal1] . . . ataaagccatcacgagtaccatagaggatc126832679In stock
BBa_J61054[HIP-1] Promoter . . . tttgtcttttcttgcttaataatgttgtca531160Not in stock
BBa_J61055[HIP-1fnr] Promoter . . . tttgtcttttcttgcttaataatgttgtca53840Not in stock
BBa_J64000rhlI promoter . . . atcctcctttagtcttccccctcatgtgtg721470Not in stock
BBa_J64010lasI promoter . . . taaaattatgaaatttgcataaattcttca533970Not in stock
BBa_J64712LasR/LasI Inducible & RHLR/RHLI repressible Promoter . . . gaaatctggcagtttttggtacacgaaagc1571866Not in stock
BBa_J64800RHLR/RHLI Inducible & LasR/LasI repressible Promoter . . . tgccagttctggcaggtctaaaaagtgttc531631Not in stock
BBa_J64804The promoter region (inclusive of regulator binding sites) of the B. subtilis RocDEF operon . . . cacagaacttgcatttatataaagggaaag1352065Not in stock
BBa_K091107pLux/cI Hybrid Promoter . . . acaccgtgcgtgttgatatagtcgaataaa574524It's complicated
BBa_K091117pLas promoter . . . aaaattatgaaatttgtataaattcttcag1263108It's complicated
BBa_K091143pLas/cI Hybrid Promoter . . . ggttctttttggtacctctggcggtgataa1641530It's complicated
BBa_K091146pLas/Lux Hybrid Promoter . . . tgtaggatcgtacaggtataaattcttcag1264661In stock
BBa_K091156pLux . . . caagaaaatggtttgttatagtcgaataaa551608Not in stock
BBa_K091157pLux/Las Hybrid Promoter . . . ctatctcatttgctagtatagtcgaataaa552254Not in stock
BBa_K100000Natural Xylose Regulated Bi-Directional Operator . . . gttacgtttatcgcggtgattgttacttat3031977It's complicated
BBa_K100001Edited Xylose Regulated Bi-Directional Operator 1 . . . gttacgtttatcgcggtgattgttacttat3032220It's complicated
BBa_K100002 Edited Xylose Regulated Bi-Directional Operator 2 . . . gttacgtttatcgcggtgattgttacttat3032062It's complicated
BBa_K112118rrnB P1 promoter . . . ataaatgcttgactctgtagcgggaaggcg5032103In stock
BBa_K112320{< ftsAZ promoter >} in BBb format . . . aaaactggtagtaggactggagattggtac7731938It's complicated
BBa_K112322{Pdps} in BBb format . . . gggacacaaacatcaagaggatatgagatt3481848It's complicated
BBa_K112402promoter for FabA gene - Membrane Damage and Ultrasound Senstitive . . . gtcaaaatgaccgaaacgggtggtaacttc2564135It's complicated
BBa_K112405Promoter for CadA and CadB genes . . . agtaatcttatcgccagtttggtctggtca3703964It's complicated
BBa_K112406cadC promoter . . . agtaatcttatcgccagtttggtctggtca23471785It's complicated
BBa_K112701hns promoter . . . aattctgaacaacatccgtactcttcgtgc6692559Not in stock
BBa_K112900Pbad . . . tcgataagattaccgatcttacctgaagct12251439Not in stock
BBa_K116001nhaA promoter, that can be regulated by pH and nhaR protein. . . . cgatctattcacctgaaagagaaataaaaa2745780It's complicated
BBa_K116401external phosphate sensing promoter . . . attaatgatcgcaacctatttattacaaca4921367In stock
BBa_K116500OmpF promoter that is activated or repressesed by OmpR according to osmolarity. . . . aaacgttagtttgaatggaaagatgcctgc1261250It's complicated
BBa_K116603pRE promoter from λ phage . . . tttgcacgaaccatatgtaagtatttcctt481264It's complicated
BBa_K117002LsrA promoter (indirectly activated by AI-2) . . . taacacttatttaattaaaaagaggagaaa1027117In stock
BBa_K118011PcstA (glucose-repressible promoter) . . . tagaaacaaaatgtaacatctctatggaca13112306In stock
BBa_K121011promoter (lacI regulated) . . . acaggaaacagctatgaccatgattacgcc2321333Not in stock
BBa_K135000pCpxR (CpxR responsive promoter) . . . agcgacgtctgatgacgtaatttctgcctc5514852It's complicated
BBa_K136010fliA promoter . . . gttcactctataccgctgaaggtgtaatgg3452453It's complicated
BBa_K145150Hybrid promoter: HSL-LuxR activated, P22 C2 repressed . . . tagtttataatttaagtgttctttaatttc662130It's complicated
BBa_K1520010Prlux-rbs-rfp-Ter . . . caccttcgggtgggcctttctgcgtttata9321622It's complicated
BBa_K1520515MC7-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter. . . . caccttcgggtgggcctttctgcgtttata36111361Not in stock
BBa_K1520516MC31-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter . . . caccttcgggtgggcctttctgcgtttata36101362Not in stock
BBa_K1660005RFP controlled by the PompR promoter . . . caccttcgggtgggcctttctgcgtttata97810915In stock
BBa_K180000Hybrid promoter (trp & lac regulated -- tac pR) . . . cgagcacttcaccaacaaggaccatagcat14472410In stock
BBa_K180002tac pR testing plasmid (GFP) . . . caccttcgggtgggcctttctgcgtttata23301691Not in stock
BBa_K180003PTAC testing plasmid (GFP) - basic . . . catggcatggatgaactatacaaataataa21731658Not in stock
BBa_K180004Game of Life - Primary plasmid . . . caccttcgggtgggcctttctgcgtttata31382156Not in stock
BBa_K180005GoL - Primary plasmid (part 1)/RPS - Paper primary plasmid (part 1) [LuxR generator] . . . caccttcgggtgggcctttctgcgtttata9791517It's complicated
BBa_K180006Game of Life - Primary plasmid (part 2) [lux pR, GFP and LacI generator] . . . caccttcgggtgggcctttctgcgtttata21511500Not in stock
BBa_K180007Game of Life - Secondary plasmid [tac pR, LuxI generator] . . . caccttcgggtgggcctttctgcgtttata21951479Not in stock
BBa_K180010Rock-paper-scissors - Rock primary plasmid . . . caccttcgggtgggcctttctgcgtttata38882311Not in stock
BBa_K180011Rock - Primary plasmid (part 1) [RhlR generator] . . . caccttcgggtgggcctttctgcgtttata9271448Not in stock
BBa_K180012Rock - Primary plasmid (part 2) [tac pR, mCherry and LasI generator] . . . caccttcgggtgggcctttctgcgtttata29531498Not in stock
BBa_K180013Rock-paper-scissors - Rock secondary plasmid [rhl pR, LacI generator] . . . caccttcgggtgggcctttctgcgtttata13691469Not in stock
BBa_K180014Rock-paper-scissors - Paper primary plasmid . . . caccttcgggtgggcctttctgcgtttata39522303Not in stock
BBa_K180015Paper - Primary plasmid (part 2) [tac pR, GFP and RhlI generator] . . . caccttcgggtgggcctttctgcgtttata29651488Not in stock
BBa_K180016Rock-paper-scissors - Paper secondary plasmid [lux pR, LacI generator] . . . caccttcgggtgggcctttctgcgtttata13711393Not in stock
BBa_K180017Rock-paper-scissors - Scissors primary plasmid . . . caccttcgggtgggcctttctgcgtttata38582321Not in stock
BBa_K180018Scissors - Primary plasmid (part 1) [LasR generator] . . . caccttcgggtgggcctttctgcgtttata9211452Not in stock
BBa_K180019Scissors - Primary plasmid (part 2) [tac pR, mBanana and LuxI generator] . . . caccttcgggtgggcctttctgcgtttata29291503Not in stock
BBa_K180020Rock-paper-scissors - Scissors secondary plasmid [las pR, LacI generator] . . . caccttcgggtgggcctttctgcgtttata14731397Not in stock
BBa_K206000pBAD strong . . . tgtttctccataccgtttttttgggctagc13010722In stock
BBa_K206001pBAD weak . . . tgtttctccataccgtttttttgggctagc1306382In stock
BBa_K2558001lux pR-HS . . . caagaaaatggtttgttactttcgaataaa558939It's complicated
BBa_K259005AraC Rheostat Promoter . . . ttttatcgcaactctctactgtttctccat3401934It's complicated
BBa_K259007AraC Promoter fused with RBS . . . gtttctccattactagagaaagaggggaca3604649It's complicated
BBa_K266000PAI+LasR -> LuxI (AI) . . . caccttcgggtgggcctttctgcgtttata9632325It's complicated
BBa_K266005PAI+LasR -> LasI & AI+LuxR --| LasI . . . aataactctgatagtgctagtgtagatctc8191498It's complicated
BBa_K266006PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP . . . caccttcgggtgggcctttctgcgtttata17051471It's complicated
BBa_K266007Complex QS -> LuxI & LasI circuit . . . caccttcgggtgggcctttctgcgtttata26761513It's complicated
BBa_K338029+OmpR, +(CinR-HSL) Double Promoter . . . tgctttccacgaacttgaaaacgctggagg3471440It's complicated
BBa_K427003Pm promoter of Mu bacteriophage . . . tcctcaatatcctgtgatgaataaccgtacBBa_K427002712213It's complicated
BBa_K427004Pmom promoter of Mu bacteriophage . . . tttttaagatagtggcgaattgatgcaaagBBa_K427001792244It's complicated
BBa_K658006position 3 mutated promoter lux pR-3 (luxR & HSL regulated) . . . caagaaaatggtttgttatagtcgaataaa553218Not in stock
BBa_K658007position 5 mutated promoter lux pR-5 (luxR & HSL regulated) . . . caagaaaatggtttgttatagtcgaataaa553170Not in stock
BBa_K658008position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated) . . . caagaaaatggtttgttatagtcgaataaa553301Not in stock
BBa_K731201Arabinose inducible araC-pBAD promoter . . . ctctactgtttctccatacccgtttttttg12035119In stock
BBa_K808000 araC-Pbad - Arabinose inducible regulatory promoter/repressor unit . . . tgtttctccatacccgttttttgggctaac12091028470In stock
BBa_K864400Ptac, trp & lac regulated promoter . . . aatgtgtggaattgtgagcggataacaatt6115591In stock
BBa_R0062Promoter (luxR & HSL regulated -- lux pR) . . . caagaaaatggtttgttatagtcgaataaa5561847In stock
BBa_R0065Promoter (lambda cI and luxR regulated -- hybrid) . . . gtgttgactattttacctctggcggtgata973065In stock
BBa_R0071Promoter (RhlR & C4-HSL regulated) . . . gttagctttcgaattggctaaaaagtgttc539591In stock
BBa_R0078Promoter (cinR and HSL regulated) . . . ccattctgctttccacgaacttgaaaacgc2252460In stock
BBa_R0079Promoter (LasR & PAI regulated) . . . ggccgcgggttctttttggtacacgaaagc15718233In stock
BBa_R0080Promoter (AraC regulated) . . . ttttatcgcaactctctactgtttctccat1493598In stock
BBa_R0082Promoter (OmpR, positive) . . . attattctgcatttttggggagaatggact10827930In stock
BBa_R0083Promoter (OmpR, positive) . . . attattctgcatttttggggagaatggact783262In stock
BBa_R0084Promoter (OmpR, positive) . . . aacgttagtttgaatggaaagatgcctgca1082818In stock
BBa_R1062Promoter, Standard (luxR and HSL regulated -- lux pR)
. . . aagaaaatggtttgttgatactcgaataaa562617In stock

Positively regulated E. coli σS promoters

This section lists promoters that are recognized by E. coli σS RNAP. σS is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. Since σS promoters have the same consensus promoter sequence as σ70 promoters, you may find these promoters will be weakly expressed by σ70 RNAP.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K112322{Pdps} in BBb format . . . gggacacaaacatcaagaggatatgagatt3481848It's complicated

Positively regulated E. coli σ32 promoters

This section lists promoters that are recognized by E. coli σ32 RNAP. σ32 is the major heat shock sigma factor in E. coli. Use these promoters when you want high promoter activity during heat shock. These promoters are also active under several different shock responses.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K112400Promoter for grpE gene - Heat Shock and Ultrasound Sensitive . . . ataataagcgaagttagcgagatgaatgcg984344It's complicated
BBa_K338001Heat Shock Promoter (HSP) . . . ataataagcgaagttagcgagatgaatgcg984627It's complicated
BBa_K338002K338001+R0011: Heat Shock Promoter + LacI Regulated Promoter . . . actgagcacatactagagaaagaggagaaa1813187It's complicated
BBa_K338042GFP Reporter Device, Heat-Shock Induced . . . caccttcgggtgggcctttctgcgtttata9811584It's complicated
BBa_K338062GFP Reporter Device, Heat-Shock or IPTG Induced . . . caccttcgggtgggcctttctgcgtttata10641354It's complicated
BBa_K338081Heat-Shock Activated Generator . . . gatgaatgcgtactagagaaagaggagaaa1181492It's complicated

Positively regulated E. coli σ54 promoters

This section lists promoters that are recognized by E. coli σ54 RNAP. σ54 is a minor E. coli sigma factor that is most highly expressed during nitrogen-limitation. Use these promoters if you want promoter activity to depend on ammonia or nitrogen levels. Alternatively, since this is a minor sigma factor that recognizes promoters with a very different sequence to σ70 promoters, this sigma factor could be repurposed to be be expressed and active during some user-chosen set of environmental conditions, essentially producing a user controllable RNAP.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_J64979glnAp2 . . . agttggcacagatttcgctttatctttttt1511249Not in stock