Promoters/Catalog/Ecoli/Constitutive

ConstitutivePromoter.png

All the promoters on this page are E. coli promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcription factors. If you find any promoters on this page that you know to be regulated by a particular transcription factor, please let us know, or re-categorize the part yourself!

Contents

Constitutive E. coli σ70 promoters

This section lists promoters that are recognized by E. coli σ70 RNAP. σ70 is the major E. coli sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
BBa_I14018P(Bla) . . . gtttatacataggcgagtactctgttatgg
BBa_I14033P(Cat) . . . agaggttccaactttcaccataatgaaaca
BBa_I14034P(Kat) . . . taaacaactaacggacaattctacctaaca
BBa_I732021Template for Building Primer Family Member . . . acatcaagccaaattaaacaggattaacac
BBa_I742126Reverse lambda cI-regulated promoter . . . gaggtaaaatagtcaacacgcacggtgtta
BBa_J01006Key Promoter absorbs 3 . . . caggccggaataactccctataatgcgcca
BBa_J23100constitutive promoter family member . . . ggctagctcagtcctaggtacagtgctagc
BBa_J23101constitutive promoter family member . . . agctagctcagtcctaggtattatgctagc
BBa_J23102constitutive promoter family member . . . agctagctcagtcctaggtactgtgctagc
BBa_J23103constitutive promoter family member . . . agctagctcagtcctagggattatgctagc
BBa_J23104constitutive promoter family member . . . agctagctcagtcctaggtattgtgctagc
BBa_J23105constitutive promoter family member . . . ggctagctcagtcctaggtactatgctagc
BBa_J23106constitutive promoter family member . . . ggctagctcagtcctaggtatagtgctagc
BBa_J23107constitutive promoter family member . . . ggctagctcagccctaggtattatgctagc
BBa_J23108constitutive promoter family member . . . agctagctcagtcctaggtataatgctagc
BBa_J23109constitutive promoter family member . . . agctagctcagtcctagggactgtgctagc
BBa_J23110constitutive promoter family member . . . ggctagctcagtcctaggtacaatgctagc
BBa_J23111constitutive promoter family member . . . ggctagctcagtcctaggtatagtgctagc
BBa_J23112constitutive promoter family member . . . agctagctcagtcctagggattatgctagc
BBa_J23113constitutive promoter family member . . . ggctagctcagtcctagggattatgctagc
BBa_J23114constitutive promoter family member . . . ggctagctcagtcctaggtacaatgctagc
BBa_J23115constitutive promoter family member . . . agctagctcagcccttggtacaatgctagc
BBa_J23116constitutive promoter family member . . . agctagctcagtcctagggactatgctagc
BBa_J23117constitutive promoter family member . . . agctagctcagtcctagggattgtgctagc
BBa_J23118constitutive promoter family member . . . ggctagctcagtcctaggtattgtgctagc
BBa_J23119constitutive promoter family member . . . agctagctcagtcctaggtataatgctagc
BBa_J231501bp mutant from J23107 . . . ggctagctcagtcctaggtattatgctagc
BBa_J231511bp mutant from J23114 . . . ggctagctcagtcctaggtacaatgctagc
BBa_J44002pBAD reverse . . . aaagtgtgacgccgtgcaaataatcaatgt
BBa_J48104NikR promoter, a protein of the ribbon helix-helix family of trancription factors that repress expre . . . gacgaatacttaaaatcgtcatacttattt
BBa_J54200lacq_Promoter . . . aaacctttcgcggtatggcatgatagcgcc
BBa_J56015lacIQ - promoter sequence . . . tgatagcgcccggaagagagtcaattcagg
BBa_J64951E. Coli CreABCD phosphate sensing operon promoter . . . ttatttaccgtgacgaactaattgctcgtg
BBa_K088007GlnRS promoter . . . catacgccgttatacgttgtttacgctttg
BBa_K119000Constitutive weak promoter of lacZ . . . ttatgcttccggctcgtatgttgtgtggac
BBa_K119001Mutated LacZ promoter . . . ttatgcttccggctcgtatggtgtgtggac
BBa_K1330002Constitutive promoter (J23105) . . . ggctagctcagtcctaggtactatgctagc
BBa_K137029constitutive promoter with (TA)10 between -10 and -35 elements . . . atatatatatatatataatggaagcgtttt
BBa_K137030constitutive promoter with (TA)9 between -10 and -35 elements . . . atatatatatatatataatggaagcgtttt
BBa_K137031constitutive promoter with (C)10 between -10 and -35 elements . . . ccccgaaagcttaagaatataattgtaagc
BBa_K137032constitutive promoter with (C)12 between -10 and -35 elements . . . ccccgaaagcttaagaatataattgtaagc
BBa_K137085optimized (TA) repeat constitutive promoter with 13 bp between -10 and -35 elements . . . tgacaatatatatatatatataatgctagc
BBa_K137086optimized (TA) repeat constitutive promoter with 15 bp between -10 and -35 elements . . . acaatatatatatatatatataatgctagc
BBa_K137087optimized (TA) repeat constitutive promoter with 17 bp between -10 and -35 elements . . . aatatatatatatatatatataatgctagc
BBa_K137088optimized (TA) repeat constitutive promoter with 19 bp between -10 and -35 elements . . . tatatatatatatatatatataatgctagc
BBa_K137089optimized (TA) repeat constitutive promoter with 21 bp between -10 and -35 elements . . . tatatatatatatatatatataatgctagc
BBa_K137090optimized (A) repeat constitutive promoter with 17 bp between -10 and -35 elements . . . aaaaaaaaaaaaaaaaaatataatgctagc
BBa_K137091optimized (A) repeat constitutive promoter with 18 bp between -10 and -35 elements . . . aaaaaaaaaaaaaaaaaatataatgctagc
BBa_K256002J23101:GFP . . . caccttcgggtgggcctttctgcgtttata
BBa_K256018J23119:IFP . . . caccttcgggtgggcctttctgcgtttata
BBa_K256020J23119:HO1 . . . caccttcgggtgggcctttctgcgtttata
BBa_K256033Infrared signal reporter (J23119:IFP:J23119:HO1) . . . caccttcgggtgggcctttctgcgtttata
BBa_K292000Double terminator + constitutive promoter . . . ggctagctcagtcctaggtacagtgctagc
BBa_K292001Double terminator + Constitutive promoter + Strong RBS . . . tgctagctactagagattaaagaggagaaa
BBa_K418000IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca
BBa_K418002IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca
BBa_K418003IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca
BBa_M13101M13K07 gene I promoter . . . cctgtttttatgttattctctctgtaaagg
BBa_M13102M13K07 gene II promoter . . . aaatatttgcttatacaatcttcctgtttt
BBa_M13103M13K07 gene III promoter . . . gctgataaaccgatacaattaaaggctcct
BBa_M13104M13K07 gene IV promoter . . . ctcttctcagcgtcttaatctaagctatcg
BBa_M13105M13K07 gene V promoter . . . atgagccagttcttaaaatcgcataaggta
BBa_M13106M13K07 gene VI promoter . . . ctattgattgtgacaaaataaacttattcc
BBa_M13108M13K07 gene VIII promoter . . . gtttcgcgcttggtataatcgctgggggtc
BBa_M13110M13110 . . . ctttgcttctgactataatagtcagggtaa
BBa_M31519Modified promoter sequence of g3. . . . aaaccgatacaattaaaggctcctgctagc
BBa_R1074Constitutive Promoter I . . . caccacactgatagtgctagtgtagatcac
BBa_R1075Constitutive Promoter II . . . gccggaataactccctataatgcgccacca
BBa_S03331--Specify Parts List--ttgacaagcttttcctcagctccgtaaact

Constitutive E. coli σS promoters

This section lists promoters that are recognized by E. coli σS RNAP. σS is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. Since σS promoters have the same consensus promoter sequence as σ70 promoters, you may find these promoters will be weakly expressed by σ70 RNAP.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
BBa_J45992Full-length stationary phase osmY promoter . . . ggtttcaaaattgtgatctatatttaacaa
BBa_J45993Minimal stationary phase osmY promoter . . . ggtttcaaaattgtgatctatatttaacaa

Constitutive E. coli σ32 promoters

This section lists promoters that are recognized by E. coli σ32 RNAP. σ32 is the major heat shock sigma factor in E. coli. Use these promoters when you want high promoter activity during heat shock. These promoters are also active under several different shock responses.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
BBa_J45504htpG Heat Shock Promoter . . . tctattccaataaagaaatcttcctgcgtg

Constitutive E. coli σ54 promoters

This section lists promoters that are recognized by E. coli σ54 RNAP. σ54 is a minor E. coli sigma factor that is most highly expressed during nitrogen-limitation. Use these promoters if you want promoter activity to depend on ammonia or nitrogen levels. Alternatively, since this is a minor sigma factor that recognizes promoters with a very different sequence to σ70 promoters, this sigma factor could be repurposed to be be expressed and active during some user-chosen set of environmental conditions, essentially producing a user controllable RNAP.


There are no parts for this table