Primers/Catalog

< Back to Primers

Sequencing partsAmplifying partsAmplifying plasmid backbonesGFP/YFP/CFP primersCommon primers

Sequencing of BioBrick parts

When working with BioBrick parts, a common operation is to verify the sequence of the cloned BioBrick part. To sequence the part, most people send sequencing samples to either a core facility at their institution or to commercial DNA sequencing services. The sample should include not only DNA encoding the part, either in linear form from PCR or as circular plasmid DNA, but also a primer to direct where sequencing should begin. Thus, for convenience, most BioBrick plasmid backbones include standard primer annealing sites for the VF2 and VR primers. The VF2 and VR primers flank the BioBrick cloning site but are sufficiently distant from the cloning site to ensure high quality sequencing reads. (Generally, sequencing only starts to yield good quality sequence reads about 50-75 bases from the 3' end of the sequencing primer.)


More...
-?-NameDescriptionSequenceDirectionTarget%GCTmLength
MWBBa_G00100Forward primer for sequencing/amplifying BioBrick parts (VF2)tgccacctgacgtctaagaaF 50 60C20
MWBBa_G00101Reverse primer for sequencing/amplifying BioBrick parts (VR)attaccgcctttgagtgagcR 50 60C20
MWBBa_G00121Reverse Primer to C0012cagtcgggaaacctgtcgtgR 60 64C20
MWBBa_G00400Forward Primer to C0040cacctactactgatagtatgccgccF 52 76C25
MWBBa_G00401Reverse Primer to C0040gcggacccactttcacatttaagR 47 68C23
MWBBa_G00700Forward primer for I0500 (pBAD)agatttatcgccagcagctcF 50 60C20
MWBBa_G00701Reverse primer for I0500 (pBAD)gccaacggttatctcgatttR 45 58C20


Amplification of BioBrick parts

When working with BioBrick parts, a common operation is to verify the length of the cloned BioBrick part by amplifying the part using colony PCR and checking the length using agarose gel electrophoresis. Most BioBrick plasmids have two pairs of primers that can be used for colony PCR. The first is the VF2 and VR primers, which flank the BioBrick cloning site but add approximately 200 nucletides to the PCR product length, depending on the vector. The second pair is the BioBrick-f and BioBrick-r primers which anneal to the BioBrick prefix and BioBrick suffix sequences, respectively.

Note that the VF2 and VR primers do not work well with all BioBrick parts. See notes on using the VF2 and VR primers.


More...
-?-NameDescriptionSequenceDirectionTarget%GCTmLength
MWBBa_G00100Forward primer for sequencing/amplifying BioBrick parts (VF2)tgccacctgacgtctaagaaF 50 60C20
MWBBa_G00101Reverse primer for sequencing/amplifying BioBrick parts (VR)attaccgcctttgagtgagcR 50 60C20
MWBBa_G00120Forward Primer to C0012gcttgctgcaactctctcagggF 59 70C22
MWBBa_G00121Reverse Primer to C0012cagtcgggaaacctgtcgtgR 60 64C20
MWBBa_G00400Forward Primer to C0040cacctactactgatagtatgccgccF 52 76C25
MWBBa_G00401Reverse Primer to C0040gcggacccactttcacatttaagR 47 68C23
MWBBa_G00500Forward Primer to C0050ggaaaacaatgcacgttaagcgF 45 64C22
MWBBa_G00501Reverse Primer to C0050ctgcctaatgaggactttggctagR 50 72C24
MWBBa_G00510Forward Primer to C0051gatttctgcatagccagacttgggF 50 72C24
MWBBa_G00511Reverse Primer to C0051cactgactagcgataactttccccacR 50 78C26
MWBBa_G00520Forward Primer to C0052ctggtcatagatggcggtcagaagF 54 74C24
MWBBa_G00521Reverse Primer to C0052gctacgaattttaccctcgcttccR 50 72C24
MWBBa_G00530Forward Primer to C0053gaaggtgaaaacgaggccacattcF 50 72C24
MWBBa_G00531Reverse Primer to C0053gctggaagatttgcgagttttgc 47 68C23
MWBBa_G00600Forward Primer to C0060gtacagcgtgctgaatatgaggc 52 70C23
MWBBa_G00601Reverse Primer to C0060gcgattgatgccctggagtatg 54 68C22
MWBBa_G00700Forward primer for I0500 (pBAD)agatttatcgccagcagctcF 50 60C20
 WBBa_G1004Forward BioBrick prefix primer for amplifying BioBrick parts (BioBrick-f)gtttcttcgaattcgcggccgcttctagF 53 86C28
 WBBa_G1005Reverse BioBrick suffix primer for amplifying BioBrick parts (BioBrick-r)gtttcttcctgcagcggccgctactagtaR 55 90C29


Amplification of BioBrick plasmid backbones

When cloning and assembling BioBrick parts, you'll need DNA encoding a BioBrick plasmid backbone. One source of DNA is to miniprep plasmid DNA from cell culture. Alternatively, you can PCR amplify the backbone DNA using the Suffix-f and Prefix-r primers. PCR amplification of the plasmid backbone followed by restriction digest and gel purification has the advantage of greatly reducing contaminating intact plasmid DNA in your assembly ligation reaction.

Primers BBa_G1000 and BBa_G1001 are used in Jason Kelly's measurement kit. Primers BBa_G1002 and BBa_G1003 are used by Meagan Lizarazo at the Registry.


More...
-?-NameDescriptionSequenceDirectionTarget%GCTmLength
 WBBa_G1000Forward primer for amplifying BioBrick plasmid backbones by PCR (Suffix-f)tactagtagcggccgctgcagF 61 68C21
 WBBa_G1001Reverse primer for amplifying BioBrick plasmid backbones by PCR (Prefix-r)ctctagaagcggccgcgaattcR 59 70C22
 WBBa_G1002Forward primer for amplifying BioBrick plasmid backbones by PCR (Suffix-f)actagtagcggccgctgcagF 65 66C20
 WBBa_G1003Reverse primer for amplifying BioBrick plasmid backbones by PCR (Prefix-r)tctagatgcggccgcgaattcR 57 66C21


Sequencing of long composite BioBrick parts

Composite BioBrick parts can quickly become too long to be completely sequenced by the VF2 and VR primers. In such cases, it can be useful to also sequence the BioBrick composite part via internal primers. For convenience, we include some primers that binds to common BioBrick reporters, such as the fluorescent proteins GFP, CFP and YFP.


More...
-?-NameDescriptionSequenceDirectionTarget%GCTmLength
MWBBa_G00200Forward primer for sequencing composite parts; binds to CFP/YFP (BBa_E0020/22, BBa_E0030/32)ccacaagttcagcgtgtccg 60 64C20
 WBBa_G00201Reverse primer for sequencing composite parts; binds to GFP (BBa_E0040)acgtgtcttgtagttcccgtcaR 50 66C22
   BBa_K863103Cellulose binding Domain from Cellulomonas Fimi with Reporter GFP . . . aaacatcaccatcaccatcacaccggttaa 42312C1111
   BBa_K863104Cellulose binding Domain from C. Fimi with const. Promotor and GFP . . . aaacatcaccatcaccatcacaccggttaa 32378C1144
   BBa_K863113Cellulose binding Domain of C. cellulovorans cellulose binding protein with Reporter GFP . . . aaacatcaccatcaccatcacaccggttaa 42240C1075
   BBa_K863114CBD of C. cellulovorans cellulose binding protein gene with const. Promoter (J23100+J61101) and GFP . . . aaacatcaccatcaccatcacaccggttaa 42324C1117


Generic molecular biology vector primers

Historically, there are a set of primer sequences that are found in many of the common cloning vectors, such as the pUC vectors. For example, some of these primers bind to the T7, SP6 and T3 promoter sequences. Although most of these common primers aren't found in BioBrick plasmid backbones, we include them here for convenience.


More...
-?-NameDescriptionSequenceDirectionTarget%GCTmLength
MWBBa_G00103M13-F (-20)gtaaaacgacggccagtF 52 52C17
MWBBa_G00104M13-R (-26)caggaaacagctatgacR 47 50C17
MWBBa_G00105M13-F (-40)gttttcccagtcacgacF 52 52C17
MWBBa_G00106M13-F (-46)gccagggttttcccagtcacgaF 59 70C22
MWBBa_G00107M13-R (-46)gagcggataacaatttcacacaggR 45 70C24
 WBBa_G00109SP6 promoter sequencing primer, 24-mercatacgatttaggtgacactatagF 37 66C24
 WBBa_G00110T3 promoter sequencing primer, 17-mer attaaccctcactaaagF 35 46C17
 WBBa_G00111T3 promoter primer, 20-merattaaccctcactaaagggaF 40 56C20
 WBBa_G00112T3 promoter sequencing primer, 24-mergcgcgaaattaaccctcactaaagF 45 70C24
 WBBa_G00113T7 promoter sequencing primer, 20-mertaatacgactcactatagggF 40 56C20
   BBa_K863102Cellulose binding Domain of C. Fimi Exoglucanase with T7, RBS, GS-Linker (Freiburg-Standard) . . . ccctgcacggtcggcggcagcaccggttaa 18886C373
   BBa_K863103Cellulose binding Domain from Cellulomonas Fimi with Reporter GFP . . . aaacatcaccatcaccatcacaccggttaa 42312C1111
   BBa_K863112Cellulose binding domain of C. cellulovorans with T7, RBS, GS-Linker (Freiburg-Standard) . . . gaatttggatttgcaggcagcaccggttaa 12756C337
   BBa_K863113Cellulose binding Domain of C. cellulovorans cellulose binding protein with Reporter GFP . . . aaacatcaccatcaccatcacaccggttaa 42240C1075