Coding

Part:BBa_K950009:Design

Designed by: Jakob Matthes   Group: iGEM12_Tuebingen   (2012-09-13)

yeast mig1


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 715
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 284
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 921


Design Notes

Codon replacement was necessary to avoid a SpeI restriction site in the genomic DNA sequence.

...
Query  121   CCTATCTGTCATAGAGCTTTTCACAGACTGGAACATCAGACGAGACACATGAGAATTCAT  180
Sbjct  121   ........................................................A...  180
...
Query  241   GATGAACTGACGAGACACAGAAGAATTCATACAAACTCCCACCCTCGAGGTAAAAGAGGC  300
Sbjct  241   ..........................C.................................  300
...
Query  1141  AGTGGTACGAATTTGCACACTTTGGGGTATGTAATGAACCAAAATCACTTGCATTTCTCC  1200
Sbjct  1141  TC..........................................................  1200
...

Source

Sequence and information is based on the Saccharomyces Genome Database, see http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=mig1

References

Wu, J. and Trumbly, R. J. (1998), Multiple regulatory proteins mediate repression and activation by interaction with the yeast Mig1 binding site. Yeast, 14: 985–1000. doi: 10.1002/(SICI)1097-0061(199808)14:11<985::AID-YEA294>3.0.CO;2-C