Regulatory

Part:BBa_K864400:Design

Designed by: Erik Lundin   Group: iGEM12_Uppsala   (2012-09-25)


Ptac, trp & lac regulated promoter


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

Oligos ordered from SigmaAldrich were annealed to form a double stranded DNA segment, ready to be ligated into any BioBrick backbone.


Source

Created from oligos ordered from SigmaAldrich.

Oligo sequences: Ptac+ AATTCGCGGCCGCTTCTAGAGGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTA

Ptac- CTAGTAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCCTCTAGAAGCGGCCGCG

References