Coding
GFP_Freibu

Part:BBa_K863120:Design

Designed by: Moritz Müller   Group: iGEM12_Bielefeld-Germany   (2012-09-20)

green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (Freiburg-Standard)

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 4
    Illegal AgeI site found at 721
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 650


Design Notes

This BioBrick is meant to be a reporter-domain. It can be fused with the Standard 25 assembly (Freiburg).

Primer that were used to made this BioBrick:

GFP_Freiburg ACGTGAATTCGCGGCCGCTTCTAGATGGCCGGCCGTAAAGGAGAAGAACTTTTC
GFP_Freiburg_compl ACGTCTGCAGCGGCCGCTACTAGTATTAACCGGTTTTGTATAGTTCATCCATGCCATGTGT

Source

BBa_I13522

References