Part:BBa_K4874004
pbridge-BD-CRY2(UVR8N-BIC2)
pbridge-BD-CRY2(UVR8N-BIC2)
Profile
Name:pBridge-BD-CRY2(UVR8-BIC2)
Base Pairs:8170 bp
Origin:the homodimeric plant,Synthetic
Properties:UV RESISTANCE LOCUS 8 (UVR8) is an ultraviolet-B (UVB) radiation photoreceptor that mediates light responses in plants.BIC2 inhibits the photoreduction of CRY2.
Construction Design
To construct the plasmid pBridge-BD-CRY2(UVR8-BIC2) ( BBa_K4874004), we selected TRP as the promoter, PGK1 as the terminator of UVR8-BIC2; ADH1 as the promoter, and ADH1 as the terminator of CRY2 within the plasmids. Key genes of the plasmids include UVR8N397(BBa_K4874001) and BIC2(BBa_K4874002) genes. The TRP, PGK1, and UVR8N397 DNA fragments were amplified by PCR. Then we performed homologous recombination to link the 3 DNA fragments to the linear pBridge-BD-CRY2 (BBa_K4874003) vector digested by double enzyme. A schematic diagram of the plasmid construction can be shown as follows (Fig.1).
Engineering Principle
Light controlled switches regulate gene expression, which is an important tool in synthetic biology, targeted therapy of diseases and other fields. Based on the discipline of optogenetics, light-sensitive cellular proteins can be engineered to act as switches, thus promoting the efficiency of "insulin switch".
Cryptochrome 2, a blue light receptor found in Arabidopsis, is a blue/ultraviolet light receptor that can bind to CIB1 to regulate downstream signaling (primarily the expression of genes). Another protein, BIC (blue light inhibitors of cryptochrome), can bind to CRY2 to inhibit its light activation, but the inhibition speed has proven to be rather low. By fusing the UV receptor UVR8 and BIC for expression, a much more rapid "off" switch can be realized under UV light conditions.
The experiment flow chart can be shown as follow (Fig.2).
Experimental Approach
TRP1 promoter PCR amplification 134bp
TRP-Forward Primers: CATCCATACAATGGGCCATATGAATTCGGTCGAAAAAAG
TRP-Reverse Primers: CCTCCGCCATACTCCAAGCTGCCTTTGTG
TRP1 Template: pBridge plasmid
UVR8N397 PCR amplification 1213bp
UVR8-Forward Primers: CAGCTTGGAGTATGGCGGAGGATATGGCTG
UVR8-Reverse Primers: GTGTTCTTCATCCCTGAAGATGGATCGATA
UVR8 Template: UVR8 plasmid template
BIC2 PCR amplification 384bp
BIC-Forward Primers: CATCTTCAGGGATGAAGAACACCAATTTGCC
BIC-Reverse Primers: GGATAGCTAGAAGCCATATGTCAACAAGAACTCTCAAC
BIC2 Template: Arabidopsis genome DNA
Restriction endonuclease single digestion
pBridge-BD-CRYN489——Nde1 The DNA fragments of the TRP promoter, UVR8N397, and BIC were successfully amplified. These can all be seen from the gel map below (Fig.3.2).
The electrophoretic strip of the TRP promoter fell between 100 bp to 250 bp, which matched the designed length of 134 bp (Fig.3.2).
The electrophoretic strip of the UVR8N397 fell between 1000 bp to 2000 bp, which matched the designed length of 1213 bp (Fig.3.2).
The electrophoretic strip of the BIC fell between 250 bp to 750 bp, which matched the designed length of 384 bp (Fig.3.2).
Nde1 enzyme cut results
The electrophoretic strip of pBridge-BD-CRY2 (Nde1 single digestion) falls above or around 7500 bp, which matches the designed length of 8361 bp (Fig.3.1).
Homologous recombination 1731bp
Linearized vector, TRP1 product, UVR8 product, BIC2 product
Transformation
DH5a Competent Cell
Determination by Colony PCR and sequencing
The length after colony PCR should be the sum of TRP UVR8 and BIC2, which equals 1731 bp. On plate 1, electrophoretic strips 2,3, and 4 are successful and on plate 2, electrophoretic strips 1,3, and 5 are successful. (Fig.5) We use length to determine if three fragments connect. The bright band is a primer dimer.
We picked our single colony and sent them to the company for DNA sequencing, the final results indicated that there were no genetic mutations on our genes, and the recombinant plasmid in lane 4 of plate 1 was successfully constructed and validated by Sanger sequencing (Fig.6).
Transformation
The homologous recombination plasmids of pBridge-AD-CIB1, pBridge-BD-CRY2, and UVR8-BIC2 were transferred into AH109.
Culture
We used an SD double deficient medium, and yeast without inserted DNA fragments lacked Leucine and Tryptophan, making it unable to grow. However, yeast that successfully inserted fragments can grow, thereby achieving the goal of expanding culture. Transferring the plasmid into yeast can maintain a stable structure.
Functional test
Our goal is to examine whether a greater efficiency of the “off” switch can be achieved under UV conditions with the insertion of UVR8 fragments and whether UVR8 genes can work under UV with extra light conditions (dark or blue light). To visualize the results, we designed the detection of β galactosidase activity. Essentially, the quick “off” characteristic of UVR8 can be verified if the enzymatic activity shows a rapid decrease trend, and vice versa.
Therefore, we set four different light conditions: dark, dark with UV, blue light, and blue light with UV, and observed different performances of yeast cells with plasmids transformed.
As indicated in the experimental design form, the variable between experimental groups 1 and 2 is the UVR8 gene. The variable between light conditions 1 and 2 (3 and 4) is the UV light. The variable between light conditions 2 and 4 is the light condition besides UV light. The expected outcome of each condition is outlined in the design form (Table 1).
As shown in Figure 7, the activity of β-Gal was low so we believed that the pBridge-BD-CRY2(UVR8-BIC2) system did not work under dark and dark UV conditions. Under blue light conditions, the activity of β-Gal was increased with time. While under blue with UV light condition, the increasing rate of β-GAL activity in the presence of UV was slower than that in the absence of UV, indicating that the proteins UVB and BIC2 play the role of self-switch off and improve the switch “off” in pBridge-BD-CRY2(UVR8-BIC2) system.
Characterization/Measurement
To confirm whether the blue-light dependent CRY2/CIB2 system works, we performed yeast transformation of AD-CIB1 and BD-CRY2. We got these two plasmids from a company. The plasmids were transformed into E. coli DH5a to get more. Then pBridge-AD-CIB1 and pBridge-BD-CRY2 were transformed into AH109.
Because the SD medium is a double deficient enzyme medium, yeast without AD and BD implantation cannot grow, so white colonies are positive colonies.
The other parts that make up BBa_K4874004 are as follows:
Part: BBa_K4874002
Profile
Name: BIC2-CDS
Base Pairs: 351 bp
Origin: Synthetic
Properties: BIC2 is a factor that inhibits CRY2 activation.
Usage and Biology
BICs play two roles in CRY2 inhibition. On the one hand, BIC2 inhibits the photoreduction of CRY2. The binding of BIC2 does not alter the overall structure of the CRY2 PHR or FAD binding, but increases the distance between FAD and residues in the electron transfer pathway and rotates the side chain of the proton donor, D393, by approximately 52°, yielding a longer d (HD393-N5ISO). Given the important role of D393 in the photoresponse, the researchers suggest that this alteration may prevent the protonation of FAD by D393, thereby interfering with the blue-light-dependent photoresponse of CRY2[1].
On the other hand, BICs inhibit the oligomerization of light-activated CRY2 and its interactions with signaling chaperones. The PHR structural domains of CRYs mediate oligomerization and interactions with CIBs. In addition, BICs appear to prevent blue-light-dependent conformational changes in the CRY PHR structural domain. Blue light has been reported to cause a significant loss of β-folding in the α/β subregion of Chlamydomonas photolyase homolog 1 PHR43. In the structure of our BIC2-CRY2N complex, BIC2 displays a "U-shaped lock" structure in which helix 1 and helix 4 in BIC2 mainly contact the α and α/β subdomains of PHR, respectively. This lock structure can tightly stabilize the conformation of the CRY2 PHR domain [1].
Firstly, BIC2 presents as an extremely extended structure, meandering around CRY2 a/b and the groove between the structural domains, forming extensive hydrogen bonding and hydrophobic interactions with CRY2. This extensive interaction may occupy the oligomerization site of CRY2 thus inhibiting the blue-light-mediated oligomerization of CRY2, and also be able to promote the depolymerization of CRY2 oligomers to keep them in the monomeric state; moreover, BIC2 can block the interaction of CRY2 oligomers with the downstream transcription factor CIB1 thus blocking blue-light signaling. Secondly, BIC2 inhibited the photoreduction of FAD, a chromogenic molecule in CRYs proteins. During photoreduction, FAD accepts an external electron to change into FAD--, and D393 of CRY2 provides a proton to change FAD-- into FADH-. Through molecular simulation, it was found that the binding of BIC2 lengthens the path of electron and proton transfer, thus hindering electron and proton transfer and inhibiting the photoreduction of FAD. In addition, the regions where BICs interact with CRYs proteins were also found to be very conserved in different plant species by sequence comparison, predicting that this inhibition mechanism is generally applicable in plants[2].
References
[1]Ma, L., Guan, Z., Wang, Q., Yan, X., Wang, J., Wang, Z., … Yin, P. (2020). Structural insights into the photoactivation of Arabidopsis CRY2. Nature Plants. doi:10.1038/s41477-020-00800-1.
[2]Ma, L., Wang, X., Guan, Z. et al. Structural insights into BIC-mediated inactivation of Arabidopsis cryptochrome 2. Nat Struct Mol Biol 27, 472–479 (2020). https://doi.org/10.1038/s41594-020-0410-z.
Part: BBa_K4874001
Profile
Name: UVR8-N397
Base Pairs: 1191 bp
Origin: Synthetic
Properties: UV RESISTANCE LOCUS 8 (UVR8) is an ultraviolet-B (UVB) radiation photoreceptor that mediates light responses in plants.
Usage and Biology
UVR-8 (UV response locus 8) is also a photosensitive protein, which acts as a component of the plant UV-B response signaling pathway to help plants adapt to UVB (Ultraviolet B, 280-315 nm) during natural growth and mitigate UV-B-generated DNA damage [1-2]. Compared to other photosensitive proteins, UVR-8 has the advantage that it absorbs UVB through tryptophan residues and does not require cofactors for activation [3], but its disadvantage lies in the irreversibility as well as the higher phototoxicity and cellular damaging capacity of UV. Under dark conditions, UVR-8 exists as a homodimer, and COP1, an E3 ubiquitin ligase, blocks the UV response by binding to degraded UVB-responsive transcription factors; in the presence of UVB, UVR-8 depolymerizes into monomers and translocates to the nucleus, where it binds to the C-terminal WD-40 structural domain of COP1 and releases the COP1 transcriptional binding factor, a process that is not reversible. binding factor, which is irreversible [4-6].
References
[1]Repina NA, Rosenbloom A, Mukherjee A, et al. At light speed: advances in optogenetic systems for regulating cell signaling and behavior. Ann Rev Chem Biomol Eng, 2017, 8: 13–39.
[2]Heijde M, Ulm R. UV-B photoreceptor-mediated signaling in plants. Trends Plant Sci, 2012, 17(4): 230–237.
[3]Crefcoeur RP, Yin RH, Ulm R, et al. Ultraviolet-Bmediated induction of protein-protein interactions in mammalian cells. Nat Commun, 2013, 4: 1779.
[4]Di W, Hu Q, Yan Z, et al. Structural basis of ultraviolet-B perception by UVR8. Nature, 2012, 484(7393): 214–219.
[5]Cloix C, Kaiserli E, Heilmann M, et al. C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein. Proc Natl Acad Sci USA, 2012, 109(40): 16366–16370.
[6]Müller K, Engesser R, Schulz S, et al. Multi-chromatic control of mammalian gene expression and signaling. Nucleic Acids Res, 2013, 41(12): e124.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 172
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 4362
Illegal BamHI site found at 2532
Illegal XhoI site found at 1556
Illegal XhoI site found at 2295 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 2214
Illegal BsaI.rc site found at 5899
Illegal SapI site found at 187
Illegal SapI site found at 4816
| None |