

Designed by: Chia-Le Meng   Group: iGEM10_NCTU_Formosa   (2010-10-24)

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K332011

(I) Culture Bti.

Bacillus thuringiensis subsp. Israelensis (BCRC15860)

1. Prepare agar plate for Bti.

  Beef extract  3.0g
  Peptone       5.0g
  Agar          15.0g
  ddH2O         1 L
  *adjust pH to 7.0
  *No antibiotic
  *Be aware of contamination

2. Plate Bti. on the medium and incubate the cultures at 30°C overnight.

(II) Clone cry11Aa from Bti. into TA vector

1. Extract genomic DNA of Bti. by liquid nitrogen.

2. Add some ddH2O to dilute the DNA.

3. Design primers

  cry reverse:  GTGCTAACATGACTTCTACTTTAGT           Tm: 52.8°C

4. Find the best PCR condition by gradient PCR.

  Anneling temperature: 51°C±10°C
  Gradient PCR.jpg
  using 1kb marker
  lane 1~12: cry11Aa PCR product(51°C±10°C) length:2Kb

5. PCR by B-taq plus on the best condition

  Template DNA(10ng/μl)		    2.0
  B-taq buffer			            5.0
  dNTP(2mM)			            5.0
  forward primer(10μM)		            1.5
  reverse primer(10μM)		            1.5
  B-taq plus DNA polymerase(2Kb)           1.0
  ddH2O		                            34.0  
  Total				            50 μl
  94°C   5  min
  94°C  30  sec
  53°C  30  sec
  72°C  2.5 min
  72°C  10  min
  In the last two lanes are cry11Aa gene. The length is about 2Kb.

6. TA cloning

7. Digestion to confirm the cry11Aa fragment and enzyme sites.

  Cry digestion.jpg
  using 1kb marker
  lane 1: plasmid uncut
  lane 2: Not1 digestion(~2981bp,1966bp)
          [There are two Not1 sites on TA vector.]
  lane 3: EcoR1 digestion(~2997bp,1695bp,237bp)
          [There are two EcoR1 sites on TA vector and another EcoR1 site on cry11Aa.)
  The samples in following groups (1-2~2-2) are the same as group 1-1.

8. DNA sequencing

  Cry11Aa sequencing.jpg

(III) PCR mutagenesis at two enzyme sites --- EcoR1 and Spe1

1. Design primers by primerX.


2. Digestion to confirm the fragments

(IV) PCR construction of Biobrick parts

1. Design primers by Assembly standard 10.


2. PCR condition

   95°C  30  sec
   95°C  30  sec
   55°C   1  min
   72°C  2.5 min
   72°C  10  min

3. Ligation to backbones(Psb1C3).

4. Digestion to confirm the fragments

  using 1kb marker
  lane 1: plasmid(~3Kb)
  lane 2: EcoR1 digestion(~4Kb)
  lane 3: Spe1 digestion(~4Kb)
  lane 4: Pst1 digestion(~4Kb)(control)
  we successfully removed EcoR1 & Spe1 enzyme sites, and added EXSP site at ends of the cry11Aa fragment.

(V) Transform into E.coli

1. Thaw competent cells and BBa_K332011 plasmid on ice.

2. Add 2ul plasmid to competent cell and place in ice for 5 minutes.

3. Put the transformed cells into 42℃ water bath for 45 seconds.

4. Plate the cells on the appropriate media and antibiotic, such as agar plates with 25 µg/ml kanamycin.

5. Incubate the cultures at 37°C overnight.

6. colony PCR to confirm the fragment size (by prefix & suffix primers)

  using 1kb marker
  lane 1: plasmid(cry11Aa+psb1C3)
  lane 2: PCR product(EXSP+cry11Aa) (~2Kb)

7. DNA sequencing:

  Cry11Aa part sequencing.JPG

(VI) Culture with mosquito larvae and observe(under construction!)

1. Preparing larvae of Aedes, Culex and Anopheles.

2. Culture with our Mosquito Intelligent Terminator!

Improvement by 2016 FAFU-CHINA team:

Based on Chlamydomonas reintmrdtii codon optimization, we synthesis the new Cry11Aa sequence and add 2A peptide at end to construct a new part. Users can link the second sequence to Cry11Aa-2A to co-express proteins by infusion technology. Cry11Aa is cloned from Bacillus thuringiensis BRC-LLP29. It shows specific toxicity to Culex and Aedes by bioassay. The Cry protein is consisted of three functional domains. Domain I is a seven α-helices bundle. It can insert itself into a membrane by using its hydrophobic helices α4 and α5 to insert into the phospholipid bilayer. The pore formation occurs on its α3 helix. Domain II and domain III are two β-sheets which are involved in the receptor interactions. Domain II contains extremely variable loops, which are the binding site of the receptor. Domain III has the function of stabilizing the toxin. Cyt proteins have a single α-β domain which do not bind to receptors but can directly insert into the cell membrane and then form a pore causing cell death. Although Cry and Cyt proteins are two big families of δ-endotoxins, they are far related.Cyt1 and Cyt2 are two types of Cyt proteins found in Bti.. Generally, Cry proteins are believed to exert toxicity by interacting with the proteins on the brush border membrane and then insert into the membrane which takes multiple steps. At the beginning in mosquitoes' gut, the crystalline inclusions are cleaved at the disulfide bond to release the Cry pre-toxin. Then the soluble proteins are activated by being cleaved again by intestinal protease. When toxins reach to the brush border membrane microvilli, they bind to the proteins, or known as receptors on the membrane. The binding process takes two step. Firstly, the monomeric Cry toxin binds to cadherin, resulting in the formation of pre-pore oligomer as Figure1.

Figure.1 The Mechanism of Cry and Cyt Toxins

Then the oligomer binds to a GPI-anchored APN or ALP. Secondly, the previous binding induces the oligomer insertion into the lipid rafts membrane. A formation of ion permeable pore is followed by the insertion which allows small molecules to pass through the membrane. The membrane potential inevitably changes greatly, causing the swelling of cell and finally breaking down. When the cell lysis reaches to a certain degree, the midgut necrosis and epithelial denaturation follow. Then, the alkaline hypertonic inclusions in midgut enters into hemocoel and the pH of haemolymph rises causing paralysis of larvae and finally death. To increase the express level in Chlamydomonas reintmrdtii, we synthesis Chlamydomonas reintmrdtii codon optimized Cry11Aa. Meanwhile, we added 2A peptide sequence at the end of 5’ According to the published paper and the result of Swiss-model, there is no effect to the toxicity of Cry or Cyt. Users can use infusion technology to link the express vector to express toxins. You can find more information by this link:

User Reviews

UNIQ6dded8dfb9680a49-partinfo-00000000-QINU UNIQ6dded8dfb9680a49-partinfo-00000001-QINU