Other

Part:BBa_K2560072:Design

Designed by: Tobias Hensel   Group: iGEM18_Marburg   (2018-09-20)


Phytobrick version of 3'Con3_L1 Connector

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

This connectors were designed to enable flexible cloning of LVL 2 plasmids. For more informations feel free to visit our Design Page.

Source

The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector BBa_K2560002 using Golden Gate assembly. If you stuggle with de novo synthesis we recomended this site.

Forward Oligo: CTCGCGCTGCTTGGAGACGAGCT

Reverse Oligo: CTCAAGCTCGTCTCCAAGCAGCG